EzBioCloud for contamination of Illumina raw files

Question

[eozcan]

Hi,

Anybody used ContEst16S: an algorithm that identifies contaminated prokaryotic genomes using 16S RNA gene sequences from EZBiocloud for Illumina files? It gives error when I upload fasta file reads from Illumina. I unzip files and convert them to fasta. It says something went wrong in a webpage error.

[WouterDeCoster]

I'd naively assume it expects a fastq file, rather than a fasta file. Can you add a link?

[eozcan]

here is the link. I tried fastq format, it reject that format from the beginning. https://www.ezbiocloud.net/tools/contest16s

[WouterDeCoster]

I see, the page clearly says fasta format.

It says something went wrong in a webpage error.

Perhaps you could be a bit more specific here.

[eozcan]

I tried to upload a fasta concatenated file from my Illumina pair-end reads, it says "something went wrong displaying the webpage."

[WouterDeCoster]

Can you show us a few lines of your fasta file, and please add the commands you used to make the file.

[eozcan]

>NS500540:135:HFF77AFXY:1:11101:6499:1061 1:N:0:ATTACTCG+NGGATAGG
GGCATTACTTCGGGGTAGGTCTTAAATAAGAGCGCAATGTTGGTATAGGCTCCCGTTGGCACTAACGTAATCGGT
>NS500540:135:HFF77AFXY:1:11101:23445:1062 1:N:0:ATTACTCG+NGGATAGG
CGCGTTTAAAACTTGGGAATGTCTTCGTAACAGACATGCACCTCCGTTTAAACTTTGTAATACCTGAGTCTACAA
>NS500540:135:HFF77AFXY:1:11101:3974:1062 1:N:0:ATTACTCG+NGGATAGG

This is raw illumina reads concatenated using

cat eo1_S17_L001_R2_001.fastq.gz eo1_S17_L002_R2_001.fastq.gz eo1_S17_L003_R2_001.fastq.gz eo1_S17_L004_R2_001.fastq.gz > eo1_R2.fastq.gz

Then, I used fastxtoool kit to convert from fastq to fasta