How To Read Few Lines As A Single Line In A Text File,,

Question

[Kiran]

    <reporter name="GT_Hg_chr17_69994042-69994101_138264" systematic_name="chr17:69994042-69994101" active_sequence="AGCCACCCAACAGAAGCAAAAGACAACTAAGGCAGCAAATACAAGCCTACAATATATCCA" start_coord="0">
          <feature number="12921">
            <position x="1.3931461995545655" y="0.0" units="mm"/></feature>
          <gene systematic_name="chr17:69994042-69994101" primary_name="chr17:69994042-69994101" description="Unknown"></gene>
        </reporter>

       Hi all i have file as above, of size 20mb with the same data.



  if($_=~/\<reporter name\=\"(.*)\"\ssystematic_name\=\"(.*)\"\sactive_sequence\=\"(.*)\"\s.*/g){
        $ID=$1;
        $Loc=$2;
        $Seq=$3;
            print OUT"$ID\t $Loc\t $Seq\n";
          }

the problem is i could match the line only till "active_sequence" coz till there it is in a single line, but all i want to do is read the file from <reporter> to </reporter> as a single line match and so on,,,,,

so how do i this using PERL,,,,??

[Martin A Hansen]

Rule of thumb. Never parse HTML or XML with REGEX. Use appropriate modules.

[Kiran]

Because i want to match and print values of "x","y" and description with "t"

Answer 1

[Heikki]

For XML, use an XML parser.

For example, XML::Twig can stream through tags without loading everything into memory. The code will look something this:

use XML::Twig;
use Modern::Perl;

my $t= XML::Twig->new(
    TwigHandlers => { 'reporter' => \&reporter },
);
$t->parsefile( 'report.xml');

sub reporter {
    my( $t, $reporter)= @_;
    my $name = $reporter->{'att'}->{'name'};
    say $name;
    my $feature_id = $reporter->first_child('feature')->{'att'}->{'number'};
    say $feature_id;
}

If you have more than one child tag, there are methods like 'children' that return an array.

[Michael]

Kiran, use a little effort in here. Don't abuse people to do the complete coding for you. Given this answer, it is obvious what you have to do.

[Kiran]

Hi Heikki, i went through code spippet which is as below

use XML::Simple qw(:strict); my $filename = 'trial.xml'; my $library = XMLin($filename, ForceArray => 1, KeyAttr => {}, );

foreach my $reporter (@{$project->{name}}) { print $reporter->{title}->[0], "\n" }

so the above code prints all the "names" from the xml file , but how do i modify this to print details including systematicname, Activeseq,x,y, number and description which tab(\t) separated as i printed in the query, so do u have any idea,,,?

[Kiran]

Hi Heikki, i went through code spippet which is as below use XML::Simple qw(:strict); my $filename = 'trial.xml'; my $library = XMLin($filename, ForceArray => 1, KeyAttr => {}, ); foreach my $reporter (@{$project->{name}}) { print $reporter->{name}->[0], "\n" } so the above code prints all the "names" from the xml file , but how do i modify this to print details including systematicname, Activeseq,x,y, number and description which tab(\t) separated as i printed in the query, so do u have any idea,,,?

[Heikki]

Kiran, you need to first figure out how to access each of the elements you are interested. Use Data::Dumper or Data::Printer modules for that. Then use function join() to print the line out.

Answer 2

[Zev.Kronenberg]

Check out the perl special variable "$/" 'coz' it allows you to change the line delimiter. This is if I am interrupting your question correctly?

$/ = 'whatever line break'

[Kiran]

yea it works as input record separator, Perl spl char seeems to very useful, but still i have practice em,, n dono how to use em,,?

Answer 3

[Gjain]

A simple HTML or XML parser in perl should help you.

you can define your own tag and use the parsing script to parse your data.

1. resource 1
2. resource 2
3. resource 3

hope this helps.

[Kiran]

Thank you all as Gjain, maasha and Heikki said i've to learn and work using HTML and XML perl modules to get the details frm XML file.