Downloading and analyzing bovine/cattle mircoRNAs

Question

[hasani.iut6]

Hi all

I want to download microRNA of bovine/cattle. I used miRBase site. I browsed the site for the "Bos taurus" and int the bottom of the page I chose mature sequences. Did I do right?

Know, I want to find the target mRNA of these microRNAs on another animal. So I have to align these microRNAs with those mRNAs, But before aligning, Should I do any preprocessing on the microRNAs?

This is an example of a microRNA sequence:

AUAGGAACAUGGAAGAUUGUCA

Should I just change the "U" letters to the "T" or I have to complement the whole sequence?

Answer 1

[h.mon]

now, I want to find the target mRNA of these microRNAs on another animal. So I have to align these microRNAs with those mRNAs

No, aligning is not the best approach, as similarity alone is not a good predictor of miRNA / mRNA interference. You should use some miRNA target prediction software, such as TargetScan.

Also, the "canonical" target site for miRNA / mRNa interaction is the mRNA 3'-UTR, so in general target site prediction focuses on them, not whole mRNA.