Remove double vertical bar "||" at the end of the sequence in a fasta file

Question

[AP]

Hello I have a fasta file as

>jgi|FusspF23_1|104542
GGTTCTCTTGTCTGTTTTTAAAAGAGTCTCGAGACCCC||
>jgi|FusspF23_1|10121
GGGGCCGCCCTCGATTCATCAGCGAAATTGCTCAGTCGGGCG||

at the end of fasta sequence I have these symbols "||" which I want to remove. I tried using sed but in that way I will end up removing that symbol "|" in fasta sequence description line ">jgi|FusspF23_1|104542" which I don't want.

Please help.

Thank you, Ambika

Answer 1

[Pierre Lindenbaum]

sed 's/[\|]*$//' in.fasta

[Ram]

We could also have sed match the first character of a line and replace only when the line does not start with a >:

sed '/^[^>]/s/|//g' in.fasta

[AP]

Thanks you so much it works.

[GenoMax]

If an answer was helpful, you should upvote it; if the answer resolved your question, you should mark it as accepted. You can accept more than one if they work.

Answer 2

[ATpoint]

awk '{gsub("\\|\\|","");print}' in.fasta

Answer 3

[Joe]

cat file.fasta | tr -d '||' > fixed.fasta

Answer 4

[AK]

perl -pe 's/\|+$//' in.fasta