Python Program to read .fasta file to .txt file

Question

[tikshyadav19]

My file is dna.fasta

>dna1
ATATTCGGATTCGAGCTTAGGT

I want to convert it into dna.txt?

[Joe]

There's no reason to do this...file extensions are arbitrary, and fasta files are already text files.

[tikshyadav19]

for example there is file dna.fasta with some sequence i want to convert this file in dna.txt format

[Mensur Dlakic]

To add to Joe's explanation: files with .fasta extension are usually of the type ASCII text, which means plain text. They have the .fasta extension only for convenience, to signify that sequences in it have a header and a string of letters. You can give those files literally any extension (and many are used, such as .fa, .faa, .fas, .fna) without changing anything about the file contents. All of them should work just like a file with .txt extension.

[tikshyadav19]

i want to count NT after it converts in .txt

[Joe]

Please stop changing the question. Either ensure you ask the right question to start with, or open a new question, because now you’re confusing the thread for other people in future.

[ATpoint]

To make it simple, please show an example of how dna.txt is supposed to look like. Then we can provide adequate solutions.

Show the data! Words are meaningless until you finally show how this txt file is suppoed to look like.

[Joe]

.txt isnt a 'format' in the way you're thinking of.

.fasta is already .txt, you just rename it and change the extension if you desperately need it to be .txt.

[ATpoint]

To make it simple, please show an example of how dna.txt is supposed to look like. Then we can provide adequate solutions.

[Andrzej Zielezinski]

Python:

fh = open('dna.fasta')
s = fh.read()
fh.close()
oh = open('dna.txt', 'w')
oh.write(s)
oh.close()

[lakhujanivijay]

oh is open handle or OH :)

[tikshyadav19]

dna.fastq has format as

dna00022 ATATTCGGATTCGAGCTTAGGT

and

dna.txt has format as

ATATTCGGATTCGAGCTTAGGT

along with it should count the number of nucleotides in dna.txt

by using python program in idle script

[Rob]

Do you just want to remove the header lines (i.e. the > sequence_name lines that appear before each sequence)?

[Joe]

You didn’t ask for a script which counts nucleotide length.

You need to fix your question, ideally with some example input and output.

[Mensur Dlakic]

a.zielezinski's post inspired me to come up with really complicated ways to do this task.

Here is one:

python -c "print('>dna1\nATATTCGGATTCGAGCTTAGGT\n')" > dna.txt

If you really want to complicate the living daylights out of this, here is another solution:

(lambda _, __, ___, ____, _____, ______, _______, ________:
    getattr(
        __import__(True.__class__.__name__[_] + [].__class__.__name__[__]),
        ().__class__.__eq__.__class__.__name__[:__] +
        ().__iter__().__class__.__name__[_____:________]
    )(
        _, (lambda _, __, ___: _(_, __, ___))(
            lambda _, __, ___:
                chr(___ % __) + _(_, __, ___ // __) if ___ else
                (lambda: _).func_code.co_lnotab,
            _ << ________,

            (((((_____ << __) + _) << ____) - _____) << ((_______ << _____)
             - _____)) - (((((_ << ____) - _) << ___) - _) << ((((___ << __)
             + _) << ____) + ___)) - (((___ << _______) - (_ << ____)
             + _) << ((___ << ______) + _______)) - (((_ << ________)
             - _____) << ((___ << ______) - (_ << _))) + (((_____ << ______)
             + _____) << ((((___ << __) - _) << ____) + (_ << __)))
             + (((((_ << ____) + _) << ____) + _) << ((((___ << __)
             - _) << ____) - (___ << _))) - (((___ << ______)
             - _______) << ((_____ << _____))) + (((_ << ________)
             + _____) << ((((_____ << __) - _) << ___) - (_ << _)))
             + (((_______ << __) + _) << (((((_ << ___) + _)) << ____)
             - (_ << _))) + (((((___ << __) + _) << ____)
             + _____) << ((_ << _______) + (_ << _))) + (((((___ << __)
             - _) << ____) - _______) << ((((_ << ____) - _) << ___)
             - _)) - (((_ << _______) - ___) << ((_______ << ____)
             - _)) - (((_______ << ____) + _) << ((((___ << __)
             + _) << ___) - _)) - (((_______ << ____)
             + _) << ((___ << _____) - _)) - (((((_ << ____) - _) << ___)
             + _) << ((((___ << __) - _) << ___) - _)) - (((((___ << __)
             - _) << ___) - _) << ((_____ << ____) - _)) - (((((___ << __)
             - _) << ___) - _) << (((((_ << ___) + _)) << ___) - _))
             - (((_ << _______) - ___) << ((_ << ______) - _))
             - (((((___ << __) - _) << ___) - _) << ((_______ << ___)
             - _)) - (((_ << ______) - _) << ((___ << ____)))
             + (((_____ << ___) + _) << ((_____ << ___) - (_ << _)))
             - (((_______ << __) + _) << ((_ << _____) - _))
             - (((((_ << ____) - _) << __) + _) << ((___ << ___) - _))
             - ((((((_ << ___) + _)) << __) - _) << ((_ << ____) - _))
             - (_______ << ((_____ << _))) + (_ << ______) - (_ << _)
        )
    )
)(
    *(lambda _, __, ___: _(_, __, ___))(
        (lambda _, __, ___:
            [__(___[(lambda: _).func_code.co_nlocals])] +
            _(_, __, ___[(lambda _: _).func_code.co_nlocals:]) if ___ else []
        ),
        lambda _: _.func_code.co_argcount,
        (
            lambda _: _,
            lambda _, __: _,
            lambda _, __, ___: _,
            lambda _, __, ___, ____: _,
            lambda _, __, ___, ____, _____: _,
            lambda _, __, ___, ____, _____, ______: _,
            lambda _, __, ___, ____, _____, ______, _______: _,
            lambda _, __, ___, ____, _____, ______, _______, ________: _
        )
    )
)

Save this code as task.py and type:

python task.py > dna.txt

This will work only for python 2.7. I will post python 3.x code if there is interest.

[Andrzej Zielezinski]

Still laughing. This one has made my day. "I will post python 3.x code if there is interest."

[tikshyadav19]

I am not laughing sir this is really complecated.

[Buffo]

You can edit files in fasta in whatever text editor, i think it does not have sense, but you can change the extension in the prompt shell by by typing: mv file.fasta file.txt

[Kevin Blighe]

tikshyadav19, please say what you are ultimately trying to do. Are you trying to use a program that requires FASTA data in a different format?