Entering edit mode
5.2 years ago
mar.ark.parr
▴
40
Hi!
Question about KaKs_Calculator2.0
I would like to calculate Ka/Ks for the sequences below. However, the calculator doesn't work with it. The tool doesn't write any error, however the output file is empty. Does anyone have any idea what is the problem?
Kind regards, Marina
sequences
GTGGACGTGCCAATGACTTTGACCAAGGTATAAGGTTGAGCACCGGCTCCCACCGCCCCCATATGGCAATCAAATGCTCCACCAGAAAGGATCACCGTCGTTGGTAAGCCCAGACGCTCAGCCCACTCGGCGGTGATCTGGCCTACCGGTCGTTCGGCGGTGTAGGTGTCAGTAAACATGGGATAATCGAGATCATTAACCAGGCTGGTATCTAATGCCGCGAGGAACGCTCGTGGGGGTAATCCGCCCCATGAAGGGTGCCATAAACTTTTATGTCCGGCGCTGCAACGGCCACGCTGGATATCCTGCGGTGCGGTGGTACCAGACAAGAGGGCCGGTACCCAGTCACACAGCTCAATCCATGACACTGCCGCCTCACGAACAGCCACATC---AGCACGGGTGACATGTAGAATTTTTGCCCAGAACCACTCAGAGGAATAA
GTGGAAGTACCGATCACCTTGCACAACGAATACGGCTCGATCAGCGCCCCTACCGCGCCCATGTGCGCATCAAACGCCCCTACGCCGATCACGACGTTTTCGGGAATGCCCAGCTTTGCCGCCCATTCTTTTGAAATGGTGCCCATCGGTTGGTCGGAAGTTTCGGTGGTGCTGAAAAGG---CGGTCGCGGAGACCGTCGAGCAATGGGTCGAGCTCGGTGAAGAATGCATTGGACGGTAACCCGTCGAAATCCTGGTGCCAGAGCGCTTTGTGCCCTGCGGCGCAGCGCGAACGTTTCAGTTGGAGCGGATCGGTCATGCCCGTGAGCTCGGCAGAAATCCAGTCGCAATGCTCTACCCATGAGAAGGCTTGCTCGCGCACGGCCGTGTC---CACACGTAACGTGCGCAGGATTTTGGCCCAGAACCATTCCGAGGAATAG
Can you give some more info on this? eg. how did you 'pair' the sequences, how did you align them, ...
at first sight it does not seem that the sequences are correctly aligned for doing Ka/Ks calculations on it .
Hi! The problem is found and its not in sequences. I filled the input files myself and didn't put "\n" at the end of the file. Ka/Ks Calculator needs it.
@lieven.sterck Thanks for your answer! I have MSA of certain genes and take sequences from there pairwise.
that's fine, just make sure the sequences are aligned in "codon-aware" mode, otherwise your Ka/Ks calculations will not make much sense, unless that software does it itself of course (not familiar with it)
Thank you for this point! Yes, I currently it is not implemented. I found it can be done with http://translatorx.co.uk/
didn't know about that one but yes indeed it seems so.