Bowtie2 Error: *.* has more quality values than read characters

Question

[rbronste]

Running into an error with Bowtie 2 paired end alignment as follows:

bowtie2 -p 12 --local --very-sensitive-local --no-unal --no-mixed --no-discordant --dovetail --phred33 --minins 10 --maxins 700 -x /genomes/bowtie2_mm10_index -1  IgG_EB_2_S10_R1_001_adapqual.fastq -2  IgG_EB_2_S10_R2_001_adapqual.fastq -S IgG_male_2.sam

Error: Read NB551387:262:H3FMVBGXC:2:13312:12350:6675 1:N:0:TAGCTT has more quality values than read characters.

terminate called after throwing an instance of 'int' (ERR):    bowtie2-align died with signal 6 (ABRT) (core dumped)

When I do the following to look at the read in the paired fastqs I get this:

grep -A 3 "NB551387:262:H3FMVBGXC:2:13312:12350:6675" IgG_EB_2_S10_R1_001_adapqual.fastq

@NB551387:262:H3FMVBGXC:2:13312:12350:6675 1:N:0:TAGCTT

AAGCCCAGXC:2:1GGAGCCACCACTGTTGACGTCTG:1GGAGCGTGAGCCTTCAGGACTTCTTCCGTGTCCCCCA

+

6A6AAAA/EAEA///AE6/A/EAEAE//AEE/AEEE/AE/E/EEEAEE/A/EEEEEEEE<EEEEAEEEEEEAEEAE

grep -A 3 "NB551387:262:H3FMVBGXC:2:13312:12350:6675" IgG_EB_2_S10_R2_001_adapqual.fastq

@NB551387:262:H3FMVBGXC:2:13312:12350:6675 2:N:0:TAGCTT

TGTAGGTTTGGGGGACACGGAAGAAGTCCTGAAGGCTCACGCTCCAGCAGACATCCACAGAGGTGGCTCCAGCT

+

/6AA66///A///EEEEA//EEAEEE/A<//EEAEE/AEE/EAE//A/E/E/AE<EEEEA//E/6<EEEEEEEA

Wondering what may be happening? Thanks.

[i.sudbery]

There appears to be a :2: in the read sequence of the first read. Is that really there or is it a cut and paste error?

[JC]

If the sequence on the first read contains XC:2:1 smells like your file is corrupted, hopefully, you have a back-up file with their checksums to validate integrity.

[ATpoint]

These parsing errors are in my experience a signal of low memory. How much RAM do you have available?