Hello everyone!
I am looking for a real example of a DNA sequence that codes for a real (any) protein. the shorter, the better.
I have the following Fake/Randomly Generated sequence:
"AAAGAACATGACTCCAATTTCGGAACCAAGTAGTTAAATCCTGTGA"
And it has the following Fake/Not Real/Test protein sequence:
'M', 'T', 'P', 'I', 'S', 'E', 'P', 'S', 'S', '_'
'MTPISEPSS'
I need this to test some of my code, but I can't seem to find any DNA Example sequences online that code for a real protein. If anyone has an example or a way to get that from any Gene Banks, please let me know.
Regards, Juris.