CPAT error while analysis

Question

[Hyper_Odin]

I am getting this error on running CPAT

cpat.py -g merged.fa -d Human_logitModel.RData -x Human_Hexamer.tsv -o out.log

Traceback (most recent call last): File "/u/rajeshpal93/scratch/miniconda2/envs/miRNA/bin/cpat.py", line 241, in <module> main() File "/u/rajeshpal93/scratch/miniconda2/envs/miRNA/bin/cpat.py", line 229, in main print >>sys.stderr, "Input gene file is in FASTA format" TypeError: unsupported operand type(s) for >>: 'builtin_function_or_method' and '_io.TextIOWrapper'. Did you mean "print(<message>, file=<output_stream>)"?

No matter what format the input file is BED or FASTA, the error is persistent? Anyone else facing this error?

[Kristoffer Vitting-Seerup]

To determine if it is the software or the file that is the problem would you try running (part of) the fasta file via their webserver?

[Hyper_Odin]

Nope! The web server shows error while uploading. Tried uploading BED and FASTA format. The website is sending requests, but I guess the server is not responding.

Answer 1

[Kristoffer Vitting-Seerup]

I just tried the webserver with a fasta file and it worked fine so the problem is most likely your fasta file. From the error message I would look for cases where there are double ">" in the title of a sequence (e.g. ">>").

[Hyper_Odin]

Can you post the fasta file here? I downloaded a small fasta file from ucsc and tried, but it still doesn't work!! :(

[Kristoffer Vitting-Seerup]

It's just a standard fasta file with the nucleotide sequence. If you want more help you would need to post (parts of) your file.

[mathavanbioinfo]

Hello, I got the same error can you resolve it Sample fasta

MSTRG.1687.1 GGCTTATTCTTTACTTTTTCCCACTTTTCCAGGCTCAGCGGGGAGCTGTTGGATGAGAAAGAGCCTGAAGTCTTGCAGGAGTCACTGGATAGATGCTATTCAACTCCTTCAGGTTGTCTTGAACTGA CTGACTCATGCCAGCCCTACAGAAGTGCCTTTTACATATTGGAGCAACAGCGTGTTGGCTTGGCTGTTGACATGGATG