Using cutadapt over multiple adapters

Question

[dgtiezzi]

Using the FASTQC I have those overrepresented adapters (RNAseq data):

GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATATCGTATGCCGT
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGT
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAG

How is the best approach to trim them out using cutadapt? Copy and paste the sequences after -a? Can I give multiple adapters at once?

Answer 1

[Juke34]

Answer here: http://cutadapt.readthedocs.org/en/stable/guide.html#removing-adapters At "Multiple Adapters" paragraph. Briefly you can use -a option for each adapter, or use the parameter only one time providing a file containing adapters in fasta format.

[bioinformaticsfilesdrive]

Question: would cutadapt -a AdapterSeq1 -a AdapterSeq2 -a AdapterSeq3 -o output.fastq input.fastq work?

[swathishekaran93]

It will work, but Cutadapt will only trim the adapter with the best match. Please refer to the section "Trimming more than one adapter from each read" in the same documentation as Juke-34 has mentioned. Excerpt from the documentation,

By default, at most one adapter sequence is removed from each read, even if multiple adapter sequences were provided. This can be changed by using the --times option (or its abbreviated form -n).