I want to use droptag but I don't have the barcodes in .fastq format, they're in .txt ... help ?

Question

[castravete2712]

Hello, I need some help.

I have to use droptag on 2 fastq.gz files (an internship assigned work) coming from here

I want to use the droptag utility in order to demultiplex my fastq.gz files (as it extracts the cell barcodes and UMIs from the library): the syntax is like this:

droptag [options] -c config.xml barcode_reads.fastq [barcode_umi_reads.fastq] gene_reads.fastq [library_tags.fastq]

But, droptag needs a .fastq barcode files and all I have are 3 .txt files with the barcodes of the 3 rounds of SPLIT-seq barcoding: Their format is like this: For Round1 and 2:

 #WellPosition  Name    Sequence
    A1  Round1_01   /5Phos/CGCGCTGCATACTTGAACGTGATCCCATGATCGTCCGA
    A2  Round1_02   /5Phos/CGCGCTGCATACTTGAAACATCGCCCATGATCGTCCGA
    A3  Round1_03   /5Phos/CGCGCTGCATACTTGATGCCTAACCCATGATCGTCCGA
    A4  Round1_04   /5Phos/CGCGCTGCATACTTGAGTGGTCACCCATGATCGTCCGA

For Round3:

#WellPosition   Name    Sequence
A1  Round3_01   /5Biosg/CAGACGTGTGCTCTTCCGATCTNNNNNNNNNNAACGTGATGTGGCCGATGTTTCG
A2  Round3_02   /5Biosg/CAGACGTGTGCTCTTCCGATCTNNNNNNNNNNAAACATCGGTGGCCGATGTTTCG
A3  Round3_03   /5Biosg/CAGACGTGTGCTCTTCCGATCTNNNNNNNNNNATGCCTAAGTGGCCGATGTTTCG

I don't know what to do, do I have to write a script? I don't even know for now what a barcode.fastq file should look like. Or is there already an utility that solves this problem? I looked on the web but didn't find anything promising.

And yes, I tried, droptag doesn't work with .txt files.

[castravete2712]

In fact, it's okay, RNA-seq has the first raw fastq file with only the reads and the second with the barcodes, the demultiplexing phase can compute them together just fine.

[GenoMax]

So did solution suggested by @ale_abd work in your case?

[castravete2712]

No, I couldn't apply it in my case as the output is not really compatible with what droptag is searching for. But it could be a good solution for other people

Answer 1

[ale_abd]

Hello,

I'm not sure how droptag works, but maybe you can use QIIME's extract_barcodes.py script, this script will separate your fastq files into barcodes (fastq format) and sequences. Then you can just use also QIIME's split_libraries_fastq.py to demultiplex your files or give it a try to droptag with the generated files.

If you decided to use split libraries script from QIIME you only need to format your mapping file according to this format.

I hope this helps.

[castravete2712]

I'll take a look and try, thank you for your reply :)