ImportError: No module named cutadapt.scripts

0

Entering edit mode

4.9 years ago

jomagrax ▴ 40

Hi everyone Im using cutadapt 1.18, I have installed it from conda (I think, Im using CAP-miRSeq and It requires a lot of programs and Im kind of lost). Python version Python 2.7.15 :: Anaconda, Inc.

when I run cutadapt I find this problem

 /home/superuser/CAP-miRSEQ/bin/cutadapt -b AATCTCGTATGCCGTCTTCTGCTTGC -O 3 -m 17 -f fastq -q 20 /home/superuser/CAP-miRSEQ/sample_data/SRR326279_R1.fastq -o /home/superuser/CAP-miRSEQ/sample_output/fastqs//SRR326279.cutadapt.fastq --too-short-output=/home/superuser/CAP-miRSEQ/sample_output/fastqs//SRR326279.tooshort.fastq
Traceback (most recent call last):
  File "/home/superuser/CAP-miRSEQ/bin/cutadapt", line 9, in <module>
    from cutadapt.scripts import cutadapt
ImportError: No module named cutadapt.scripts
(base)

Im very new to bioinformatics so any help would be great.

Thankyou in advance, Jose

rna-seq cutadapt cap-mirseq • 1.7k views

ADD COMMENT • link 4.9 years ago by jomagrax ▴ 40

0

Entering edit mode

This does not look like a path to a conda installation. How exactly did you install it (add commands please)?

ADD REPLY • link 4.9 years ago by ATpoint 86k

0

Entering edit mode

I think cutadapt is on python3 now: https://cutadapt.readthedocs.io/en/stable/installation.html

ADD REPLY • link 4.9 years ago by curious ▴ 820

Login before adding your answer.