Map Fasta to Fasta + Bed file

Question

[Amaranta Remedios]

I've been thinking a lot about this problem and I don't know how to solve it. I have a fasta file with microRNAs precursors and a bed file with the coordinates of this precursors in a genome.

fasta file microRNAs precursors:

>LQNS02278089.1_34108
CGGTCGTGATGGGAGCAAATTTGAACAATTAAATAGCAAATTGCACTCGTCCCGGCCTGC
>LQNS02278089.1_34106
CGGTCGTGATTGGTGCAACTTGGGTCACTTAACCGCCAATTGCACTGATCCCGGCCTGC
>LQNS02278089.1_34110
CGGCCGGTATGAGGGCAAATCAATTTCTGTATAAATGACGAATTGCACTCGTCCCGGCCTTC

bed file precursors:

LQNS02278089.1  848170  848230  LQNS02278089.1_34108    2249659.3   -   848170  848230  0,0,255
LQNS02278089.1  847652  847711  LQNS02278089.1_34106    1566285.5   -   847652  847711  0,0,255
LQNS02278089.1  848490  848552  LQNS02278089.1_34110    882643.1    -   848490  848552  0,0,255

I also have a fasta file of mature microRNAs sequences that I would like to map to the precursors fasta file to obtain another bed file for the matures microRNAs.

fasta file mature microRNAs:

>LQNS02278089.1_34108
AATTGCACTCGTCCCGGCCTGC
>LQNS02278089.1_34106
AATTGCACTGATCCCGGCCTGC
>LQNS02278089.1_34110
AATTGCACTCGTCCCGGCCTTC

Any help or recommendation will be very appreciated!

Answer 1

[Kevin Blighe]

Hi, assuming that column 4 of the precursors BED file is the key for lookup, the following awk command will work. It prints non-matches, too, so that you can verify what was / was not matched. The output will be ordered exactly as per the order of the FASTA headers in your mature microRNAs FASTA file.

Tested on Ubuntu 16.04:

cat precursos.bed
LQNS02278089.1  848170  848230  LQNS02278089.1_34108    2249659.3   -   848170  848230  0,0,255
LQN_negcontrol  1   34  LQN_negcontrol  123.6   -   1   34  0,0,255
LQNS02278089.1  847652  847711  LQNS02278089.1_34106    1566285.5   -   847652  847711  0,0,255
LQNS02278089.1  848490  848552  LQNS02278089.1_34110    882643.1    -   848490  848552  0,0,255

cat mature_mir.fasta
>LQNS02278089.1_34108
AATTGCACTCGTCCCGGCCTGC
>LQNS02278090_34110
AATTGCACTCGTCCCGGCCTTC
>LQNS02278089.1_34106
AATTGCACTGATCCCGGCCTGC
>LQNS02278089.1_34110
AATTGCACTCGTCCCGGCCTTC
>LQNS02278089.1_34119
AATTGCACTCGTCCCGGCCTTC

awk 'FNR==NR {arr[$4]=$0; next} /^>/{lookup = gensub(/^>/, "", "g", $0); if (arr[lookup]) {print arr[lookup]} else {print "NA - "lookup}}' FS="\t" precursos.bed mature_mir.fasta

LQNS02278089.1  848170  848230  LQNS02278089.1_34108    2249659.3   -   848170  848230  0,0,255
NA - LQNS02278090_34110
LQNS02278089.1  847652  847711  LQNS02278089.1_34106    1566285.5   -   847652  847711  0,0,255
LQNS02278089.1  848490  848552  LQNS02278089.1_34110    882643.1    -   848490  848552  0,0,255
NA - LQNS02278089.1_34119

...or, tidied (same command broken over multiple lines):

awk 'FNR==NR {arr[$4]=$0; next} \
  /^>/{lookup = gensub(/^>/, "", "g", $0); \
    if (arr[lookup]) {print arr[lookup]} \
      else {print "NA - "lookup}}' FS="\t" precursos.bed mature_mir.fasta

Kevin