bowtie2 aligment problems

Question

[amitpande74]

Hi,

I have reads from DNA sequencing,5 pools. The reads look like this:

 @NS500455:80:HG7TNBGXB:1:11101:17723:1055 1:N:0:ATCACG
ACTTANGTGTATGTAAACTTCCGACTTCAACTGTATAGGGATCCNAGCTCCAATTCGCCCTATAGTGAGTCGTAT
+
/AAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

It's illumina primer followed by the construct of a transposon which I had to filter. So, I used cutadapt:

for file in /FASTQ/*
do
  cutadapt -g ACTTAAGTGTATGTAAACTTCCGACTTCAACTG --discard-untrimmed --minimum-length=35 "$file" -o "`basename -s .fastq &
done

Then I tried aligning this with Bowtie2 using the command :

./bowtie2-align-s -x rat/rn4 -U A1_S1_R1_001.fastq --sensitive-local -S A_align.sam

Bowtie2 fails to align majority if them :

2648325 reads; of these:
  2648325 (100.00%) were unpaired; of these:
    2242006 (84.66%) aligned 0 times
    309307 (11.68%) aligned exactly 1 time
    97012 (3.66%) aligned >1 times
15.34% overall alignment rate

I tool the aligned and the unaligned sequences and used BLAT to figure out any contamination and to see if the sequences are from the rat genome. All positive. I don't have any clue as to why this is happening. Can someone help please. regards to all.

[gb]

Besides your issue, do you have paired-end data? It looks like it but I am asking if you can confirm this. If you are not sure, do you have two files for each sample, one containing "R1" in the filename and the other "R2"?

[amitpande74]

No the reads are single end. This is how the library was prepared.

[GenoMax]

Please use ADD COMMENT/ADD REPLY when responding to existing posts to keep threads logically organized. SUBMIT ANSWER is for new answers to original question.

What is your expected read structure? I guess you are interested in sequence to right of transposon insertion? You may also want to use bowtie v.1.x instead for bowtie v.2.x since the remaining read is small.

[ATpoint]

How long are the reads after trimming?

[amitpande74]

43 base pairs after trimming. The entire read length before trimming is 75bps.

[GenoMax]

You should also not run bowtie2 directly like this bowtie2-align-s. Use the wrapper script for bowtie2.

[amitpande74]

How should the command line be:

./bowtie rat/rn4 -s file.fastq test.sam

or should the specific read be specified. I have never used this before so could you kindly help.

[GenoMax]

Something like:

bowtie2 rat/rn4 -U file.fastq -S test.sam