Error Cutadapt: FASTQ file is expected to start with '@

Question

[pingEde]

Hello, I am trying to use cutadapt in order to remove my adaptor, but it reports:

error: Line 1 in FASTQ file is expected to start with '@', but found '\n'

The head of my file is:

@SRR1688545.1.1 1 length=28
AACTATGCCGACTAGGGATCGGGTGGTG
+SRR1688545.1.1 1 length=28
CCCFFFFFHHHHHJJJJJJJJJJHIJJJ
@SRR1688545.2.1 2 length=31
TGCCAAGGACGTTTTCATTAATCAAGAACGA
+SRR1688545.2.1 2 length=31
CCCFFFFFHHHHHJJJJJJJJJJJJJJJJJI

How to make the fastq file usable for cutadapt?

Thank you in advance

[Pierre Lindenbaum]

what the output of head -n1 your.fastq or gunzip -c your.fastq.gz | head -n 1

[pingEde]

the output is: @SRR1688545.1.1 1 length=28

I use this dataset http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?exp=SRX793383&cmd=search&m=downloads&s=seq

thank you for your help

[chetan109]

I'm having same error.. the output is: @SRR4042503.1.1 1 length=51 can you suggest what can be done ?

And for another fastq file it shows: "BZh91AY&SY??F?A?????????? h??]0??R$4( 8@ej]??5?$?M?Q}?ABAB???P?(@ ?" I have just uncompressed them after downloading from the databases.

[michael.ante]

what is the output of head -n1 RB.fastq | sed -n 'l'

with this sed command, you'll display all special characters (e.g. \t,\n,\r).

[pingEde]

I am sorry but I did not see your response. the output is: @SRR1688545.1.1 1 length=28$

why there is the characters "$"?

[michael.ante]

It is the symbol for the standard line break. So far, everything seems to be OK. I thought it might be a problem with for instance a carriage return (how line breaks are coded in Windows).

[Katie D]

Hi! I am getting the same error as noe:

cutadapt: error: Line 1 in FASTQ file is expected to start with '@', but found '\n'

However, my file was always in fastq format and was not converted from sra or any other format, so I don't think that's the issue.

head -n1 your.fastq this gives me @HS3:635:H2LMVBCXX:1:1101:3109:1994 2:N:0:ACAGTG

head -n1 RB.fastq | sed -n 'l gives me @HS3:635:H2LMVBCXX:1:1101:3109:1994 2:N:0:ACAGTG$

Any ideas?

[James Ashmore]

Can you show us the command you used?

[pingEde]

cutadapt --adapter CTGTAGGCACCATCAAT --error-rate 0.1 --minimum-length 15 --overlap 1 RB.fastq --output output.fastq

[Matt Shirley]

You might have the a file with non-ASCII character encoding. What is the output of the file command?

Answer 1

[amango]

Could be a few things, but are you sure the first line is not blank? Make sure the @ is the very first character of the file.

It's hard to tell what your file looks like from the format of your post, but the line starting "+SRR..." should not be on the same line as the sequence ("AACTA...").

Answer 2

[pingEde]

Could it be a problem of the conversione from sra to fastq?

Answer 3

[gangireddy]

Have you tried placing input file at the end of the command like

cutadapt --adapter CTGTAGGCACCATCAAT --error-rate 0.1 --minimum-length 15 --overlap 1 --output output.fastq RB.fastq

Answer 4

[pingEde]

I used this command many times and I had not problem... I think that the problem is in the fastq

Answer 5

[pingEde]

After the download of the sra file and the conversion in fastq, cutadapat worked!