How to call and INDEL using GATK

Question

[Kumar]

I am using gatk-4.1.7.0 version with following command, however I am getting error. please advice....

Command:

gatk-4.1.7.0$./gatk HaplotypeCaller -R /home/kumarm/allan-work/RNASEq-alignment/ref_sequence.fa -I /home/kumarm/allan-work/RNASEq-alignment/sorted-out-align.bam -O /home/kumarm/allan-work/RNASEq-alignment/raw_variants.vcf

ERROR:::

A USER ERROR has occurred: The specified fasta file (file:///home/kumarm/allan-work/RNASEq-alignment/ref_sequence.fa) does not exist.

---

Set the system property GATK_STACKTRACE_ON_USER_EXCEPTION (--java-options '-DGATK_STACKTRACE_ON_USER_EXCEPTION=true') to print the stack trace.

[Tm]

Please check the path you have specified for reference sequence. Error clearly tells that there is no reference fasta in the path provided.

[Kumar]

The error because I have not generated .dict and .fai files with reference.fasta. However, now I have provided these so it is showing following ERROR:

A USER ERROR has occurred: Input files reference and reads have incompatible contigs: No overlapping contigs found. reference contigs = [KF267450.1] reads contigs = []

---

Set the system property GATK_STACKTRACE_ON_USER_EXCEPTION (--java-options '-DGATK_STACKTRACE_ON_USER_EXCEPTION=true') to print the stack trace.

[Kumar]

Hi I have fastq (MnION) file and a reference fasta file..I have still issue to not getting results ......

--FILE 1

@ID_5331388 CTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCC +ID_5331388 AAFFFJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJ7FFJJJJJJJJJFJJJFJJJJJJJJJJJJJFJJJJJJJJJJJJJJJ @ID_6694963 CTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGATGGGAATTCTCCTCCACTCTGGGCTGGGAATTCTCCTCCACTCTGGGATGGGCATTCTCCTCC +ID_6694963 AAAFFJJJJJJJFJJJJJFJJFJJJJJJJJJJJJJJFJJJF<fjjjjjjjjj-aj&lt;-ajf-7jff7--7&lt;7fffjj-&lt;<aa-ff-<faj))-af-----)< p="">

---FILE 2

KF267450.1 TTAAAAGAGATTTTCTATCTACGGATAGTTAGCTCTTTTTCTAGACTCTTGTCTACTCAATTCAACTAAA CGAAATTTTGTCCTTCCGGCCGCATGTCCATGCTGCTGGAAGCTGACGTGGAATTTCATTAGGTTTGCTT

--ERROR--

A USER ERROR has occurred: Input files reference and reads have incompatible contigs: No overlapping contigs found. reference contigs = [KF267450.1] reads contigs = []

Answer 1

[lakhujanivijay]

Hi Manoj

That's a header incompatibility issue and can be resolved by editing your reference fasta file. Here are few suggestions:

1. check the headers of your reference fasta file:

   grep "^>" /home/kumarm/allan-work/RNASEq-alignment/ref_sequence.fa

2. check the header of your bam file :

   samtools view -H /home/kumarm/allan-work/RNASEq-alignment/sorted-out-align.bam

If your sequence with header KF267450.1 is not found or partially found in the output from step#2 above,then either you have used a difference reference for alignment or you need to rename the BAM header to match with the reference fasta headers.

[Kumar]

Thank you for your suggestion. I have figure out by using add read group as following command..

./hisat2 --rg ID:@SRR8136651.1 --rg SM:103 --rg PL:ILLUMINA --rg LB:lib-103 --rg PU:@SRR8136651.1.NoIndex -p 8 -q -x ../file.fastq -S ../file.sam