Automatically change N for consensus sequence

0

Entering edit mode

4.5 years ago

dasilvauirajan ▴ 20

I have thousands of fasta sequences, and many of them have N letters in the middle os alignment. I would like to use this sequences to test a tool, but i don't want just retire de N letters, but change it for consensus of my whole alignment. Any way to do it easily?

fasta • 747 views

ADD COMMENT • link 4.5 years ago by dasilvauirajan ▴ 20

0

Entering edit mode

It is nucleotide sequences by the way

ADD REPLY • link 4.5 years ago by dasilvauirajan ▴ 20

0

Entering edit mode

can you please rephrase the question or give an example?

ADD REPLY • link 4.5 years ago by cpad0112 21k

0

Entering edit mode

Consense:                 TGATGTCTATTAATTACGTA
My fasta sequences:       TGATGTCTNNNNNTACGTA
                          TGNNNTCTATTAATTACGTA
                          TGATGTCTATTAATTACGTA

I want to replace the N letters with correspondent consense letter

ADD REPLY • link updated 4.5 years ago by GenoMax 147k • written 4.5 years ago by dasilvauirajan ▴ 20

0

Entering edit mode

Please define an invariable sequence with in the pattern. If every position is replaceable, it is not easy to replace the Ns.

ADD REPLY • link 4.5 years ago by cpad0112 21k

Login before adding your answer.