miRDeep2 problem with reads_collapsed.fa

Question

[LynxLynx]

Hello everyone! I'm trying to run mirdeep2.pl Command I use is following: miRDeep2.pl reads_collapsed.fa Lusitatissimum_200_BGIv1.0.fa SRR8582417.arf none none none

1) reads_collapsed.fa file was created with SAM to ARF built-in mirdeep2 converter and has the following content:

>seq_1_x1
CTTATAGTGTAAGGTGGAATGAAG
>seq_2_x1
ATGTCACCGAGTCTGTTACGCAAT
>seq_3_x2
AGGGAAGAAGAACTAATATTTG
.......

2) Lusitatissimum_200_BGIv1.0.fa is my reference genome

3) SRR8582417.arf was generated with converter as well

miRDeep2 starts to run, but then it crashes with the error:

> #testing input files
> #testing input files sanity_check_reads_ready_file.pl reads_collapsed.fa
> 
> started: 23:31:07 Error: problem with reads_collapsed.fa Error in line
> 434.802: Either the sequence contains less than 17 characters or contains characters others than [acgtunACGTUN]
> 
> Please make sure that your file only comprises sequences that have at
> least 17 characters
> 
> containing letters [acgtunACGTUN]

Both statements are false actually and alll files are in the working directory What's the problem?

Answer 1

[Barry Digby]

Take a look at this tutorial A: mireap procedure short tutorial

You will need to split the fasta headers so that the collapsed read counts have a space separating the ID and count using sed

>seq_1_x1
CTTATAGTGTAAGGTGGAATGAAG

to

>seq_1_x 1
CTTATAGTGTAAGGTGGAATGAAG

[LynxLynx]

Thank you! But there was a test file in mirdeep2/tutorial. I ran mirdeep with my files + this test file and it was ok.

>seq_0_x149538
TCACCGGGTGGAAACTAGCAGT

But this file has the same header' structure as mine. Why does it work?

[Barry Digby]

sorry, I must have had it confused with mireap. are you sure the sequence lengths are all above 17? you might have to dig deeper into that.

awk '/^>/{if (l!="") print l; print; l=0; next}{l+=length($0)}END{print l}' test.fa > lenghts.txt

and parse output

[LynxLynx]

I have removed all strings shorter than 18 with mapper.pl reads.fa -c -j -l 18 -m -s reads_collapsed.fa

Just to be sure I also removed all non-printable chrs using command line sed 's/[^[:print:]]//g' reads.fa > clean.fa

Did not help(

Then I just removed line 434.802, didn't help as well

[LynxLynx]

By the way, the error is still in line 434.802 though I removed it

Answer 2

[LynxLynx]

I just mapped reads again using mirdeep2 and obtained ARF file. So I didn't have to use converter :)

[Barry Digby]

It worked? great! So the solution was to remake the arf file?

[di.wang1]

Hi,

How did you solve that problem?

My error is #testing input files Error: problem with /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa perl: warning: Setting locale failed. perl: warning: Please check that your locale settings: LANGUAGE = "en_IE:en", LC_ALL = (unset), LC_CTYPE = "UTF-8", LANG = "en_IE.UTF-8" are supported and installed on your system. perl: warning: Falling back to a fallback locale ("en_IE.UTF-8").

But it didnot say what the problem is.

And my code is :miRDeep2.pl /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa /home/workspace/wangdi/cattle_miRNA/test/5_ref/bta.fa /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185.arf none none none -t Cow

In addition, when I use the bta_mature and bta_hairpin miRNA fasta file (generate from miRBase), the errer is "problem bta_mature.fa".

This really annoys me for weeks. Does anyone have idea about this?

Thanks a lot.

Di.

Answer 3

[di.wang1]

Hi,

How did you solve that problem?

My error is "#testing input files Error: problem with /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa perl: warning: Setting locale failed. perl: warning: Please check that your locale settings: LANGUAGE = "en_IE:en", LC_ALL = (unset), LC_CTYPE = "UTF-8", LANG = "en_IE.UTF-8" are supported and installed on your system. perl: warning: Falling back to a fallback locale ("en_IE.UTF-8")."

But it didnot say what the problem is.

And my code is :miRDeep2.pl /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185_collapsed.fa /home/workspace/wangdi/cattle_miRNA/test/5_ref/bta.fa /home/workspace/wangdi/cattle_miRNA/test/6_mapper.pl/ERR558185/ERR558185.arf none none none -t Cow

In addition, when I use the bta_mature and bta_hairpin miRNA fasta file (generate from miRBase), the errer is "problem bta_mature.fa".

This really annoys me for weeks. Does anyone have idea about this?

Thanks a lot.

Di.