How to make scaffold from contigs

Question

[jeccy.J]

Hi everyone I have a contig file looks like :

>contig1
AAAAAATTTTTTTGGGGCCC
>test234
AAATTTTGGGGGGGGGGGG
>test345
AAAAAAAAAAAAATTTTTTTT

so on............

I would like to make final file like

>contig1
AAAAAATTTTTTTGGGGCCCNNNNNNAAATTTTGGGGGGGGGGGGAAAAAAAAAAAAATTTTTTTT

Can anyone please help me out.

Kind regards, JC

[Sej Modha]

Most good de novo assembly software contains a scaffold building step as part of the pipeline, e.g. SPAdes. If you want to build scaffolds from existing contigs then you can look into SSPACE or Scaffold_builder.

[h.mon]

Please explain in more detail your problem, and what you want to solve. For example, disclose what type of organism you are working with, what is the source of the contigs, if you have additional data to perform scaffolding, and so on.

Right now, there isn't enough information in your question for us to give good answers.

Answer 1

[Mbillah]

If you have a reference genome then you can try abacas(https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2712343/). On the other hand if you don't have multiple lib or long read then scaffold will not improve so much. you can try platanus assembler which also have a scaffolding option.