Blastx Result

Question

[khikho]

I'm almost confused on blastx output length result. So the questions are:

Query= NODE_2160645-0;57 Length=82

ref|XP_002833304.1| PREDICTED: hypothetical protein LOC100444373 [Pongo abelii]

Length=134

Score = 37.7 bits (86), Expect = 0.74

Identities = 11/14 (78%), Positives = 14/14 (100%), Gaps = 0/14 (0%)

1)Query length has been reported 82! (but It's 57) ?!

2)The Identities number reported in Protein digit (the number of identities protein =11 so if want the number of base 11*3=33 bp) so the length of hit (134) is in bp or protein pare !? if it's in bp why it's not dividable by 3 ?! (the result 134/3 is not integer)

Thanks

[Michael]

Please help by posting the query sequence fasta entry (only NODE_2160645 !), blastx version and commandline parameters and the full alignment output for this hsp. That will give a reproducible example.

[khikho]

Because of formatting I put them in Answer part

Answer 1

[khikho]

Question 1 Solved [It's human mistake]

NODE_2160645-0;57 GTAAGGTGAGAAAAAAAAAAAACGGAAGACTTGCCTTTCTCCAGTCCATTCCGTTCAATC CATTCCATTCCAGTCCATTCCA

blastx -query contigs.out -db nr .....

version: 2.2.24+

Query= NODE_2160645-0;57

Length=82

Sequences producing significant alignments: Score(Bits) EValue

ref|XP_002833304.1| PREDICTED: hypothetical protein LOC100444373... 37.7 0.74

ref|XP_002833304.1| PREDICTED: hypothetical protein LOC100444373 [Pongo abelii]

Length=134

Score = 37.7 bits (86), Expect = 0.74

Identities = 11/14 (78%), Positives = 14/14 (100%), Gaps = 0/14 (0%)

Frame = -1

Query  82   WNGLEWNGLNGMDW  41

            WNG++WNG+NGMDW

Sbjct  100  WNGIQWNGMNGMDW  113

Lambda K H

0.318 0.134 0.401

Gapped

Lambda K H

0.267 0.0410 0.140

Effective search space used: 152859517525

[Michael]

Subject length (134) is given in amino acids, not nucleotide, because it is an amino acid database. The length of the alignment is 14 out of 134 aa.