Adapter trimming by Trimmomatic - Nextera Library

Question

[mimi]

Hi, I have paired-end read data prepared by illumina Nextera. I'm trying to remove the adapter using Trimmomatic.

illumina adaper sequence manual (p.3) says that the following sequence is used for Read 1 and Read 2 adapter trimming. CTGTCTCTTATACACATCT

However, Trimmomatic have reverse complementary sequences as PrefixNX / 1 and PrefixNX / 2. Is it necessary to specify CTGTCTCTTATACACATCT in Trimmomatic?

---

NexteraPE-PE.fa (supplied by Trimmomatic):

'>PrefixNX/1

AGATGTGTATAAGAGACAG

'>PrefixNX/2

AGATGTGTATAAGAGACAG

'>Trans1

TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

'>Trans1_rc

CTGTCTCTTATACACATCTGACGCTGCCGACGA

'>Trans2

GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

'>Trans2_rc

CTGTCTCTTATACACATCTCCGAGCCCACGAGAC

Answer 1

[colindaven]

We couldn't find a good way to do this in Trimmomatic (our preferred trimmer) and started using trim-galore in our pipeline (https://github.com/MHH-RCUG/Wochenende ) instead for nextera transposase sequences.

We found trim-galore to be much better at getting rid of residual nextera adapters. Trimmomatic did not remove adapters despite having the exact adapter and sequence added to it's reference DB, and a few (~ 0.1-0.5 %) were left in the output. We tried multiple prefixes etc too, and also another tool, fastp.

[mimi]

Thank you for the information! I'll try it.