Issue interpreting plasmidSPAdes output

Question

[A_heath]

Hi all,

I am using plasmidSPAdes for plasmid prediction on raw sequencing datas.

I ran the following command:

spades.py -o PlasmidSPades_results -1 R1_raw_reads.fastq -2 R2_raw_reads.fastq --plasmid

The program works fine but I'm having trouble interpreting the output files.

Indeed, on the file named contigs.fasta, I have several contigs with the id: component_X. Here is an example:

>NODE_1_length_43010_cov_119.234319_component_0
GCGCGTCGCCGAGCTTGTCGAGC ...
>NODE_20_length_950_cov_73.572738_component_1
TTGCTCAGCTTGTCGGTGGCTTGCCA ...
>NODE_5_length_11025_cov_340.981549_component_2
TATACGCAAATACGTATTTGCGTGATAC ...

I am assuming that because I have 3 different component IDs, my strain has 3 plasmids? Is that absolutely wrong?

If someone would help me interpreting plasmidSPAdes output, it would be very helpful!

Thank you in advance

Audrey

[5heikki]

It's extremely rare to get "closed" or "complete" molecules with whatever assembler. Just three contigs would be an extremely low number for e.g. a bacterial genome assembly. I don't know what exactly plasmid spades does. However, just looking at the headers, the length of your second contig is only 950 nt. Can plasmids be that small?