Extract primer-containing reads from RNA-Seq

Question

[Ruixuan]

Hi all,

I was wondering if there are any methods to extract reads containing the primer sequence.

My goal is to identify the transcript borders from reads, thus, I think if I could collect reads with primer mark, then these reads could represent the border part of transcripts. Then, mapping them back to the genome might give me information on TSS and TES.

My experiment is built RNA-Seq with "TruSeq Stranded mRNA LT Sample Prep Kit" to prepare the library. This kit uses Oligo-dT beads to capture polyA tails.

Any comments are welcome.

Thank you in advance.

Answer 1

[GenoMax]

You can use bbduk.sh from BBMap suite in filter mode. Replace the sequence of the primer in place of the sequence in command below.

Single-end data:

bbduk.sh in=your.fq literal=CCAGGTAGTAGTACGTCTGTT k=10 outm=interesting_seq.fq

Paired-end data:

bbduk.sh in1=your_R1.fq in2=your_R2.fq literal=CCAGGTAGTAGTACGTCTGTT k=10 outm=stdout.fq | reformat.sh in=stdin.fq out1=interesting_R1.fq out2=interesting_R2.fq

[Ruixuan]

Thank you very much!

Answer 2

[swbarnes2]

Are you completely sure that will work?

Because:

The Poly-A containing mRNA molecules are purified using poly-T oligo attached magnetic beads. Following purification, the mRNA is fragmented into small pieces using divalent cations under elevated temperature.

https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/samplepreps_truseq/truseq-stranded-mrna-workflow/truseq-stranded-mrna-workflow-reference-1000000040498-00.pdf

[Ruixuan]

Thanks for the reply. I also noticed this and cannot find any sequence of their primer. So I turned to Trinity and PASA for border annotation. If you have any advice, I'm looking forward to that. Thanks again.