How to count the number of codons in a frame or order using the equation?

Question

[USER]

Let's consider these values

If you want to understand better you can access this link: http://codonw.sourceforge.net/DataRecoding.html

how can I solve this problem?

Answer 1

[Devon Ryan]

That equation is a custom hash function that someone came up with to ensure that codons hash to unique sequential values for memory efficiency. In a modern language like python there are built in hash functions, so one could instead just do:

someSequence = 'atgatg'
d = dict()
for idx in xrange(0, len(someSequence), 3):
    codon = someSequence[idx:idx+3].upper()
    if codon not in d:
        d[codon] = 0
    d[codon] += 1

for codon, cnt in d.items():
    print('{}: {}'.format(codon, cnt))

If for some reason you absolutely HAD to use this custom hashing function, then you have to use a vector of values:

valueConversion = {'T': 1, 'U': 1, 'C': 2, 'A': 3, 'G': 4}

def customHash(codon):
    P1 = valueConversion[codon[0].upper()]
    P2 = valueConversion[codon[1].upper()]
    P3 = valueConversion[codon[2].upper()]
    return ((P1 - 1)*16) + P2 + ((P3-1)*4) - 1  # Note the conversion to 0-based indexing!

someSequence = 'atgatg'
v = [0] * 64  # N.B., python uses 0-based indexing
for idx in xrange(0, len(someSequence), 3):
    codon = someSequence[idx:idx+3].upper()
    v[customHash] += 1

Now v contains the counts starting from AAA to GGG. There are probably some typos in there. Finding and correcting these errors can be an exercise for you.

[USER]

I have some strings that have been grouped with a linux cat. And I would like to assign this cat file to that code and thus generate several frequencies according to the sequences.

[Devon Ryan]

Further help comes at a cost of 500 euro per hour (or fraction thereof). I imagine you'll want to code the last bit yourself...

[USER]

ok. Thanks! :)

[Jorge Amigo]

Did you check my answer? [sigh]

$ echo "atguuucccggggtataaggcaaaa" | perl -ne '$cs{$1}++ while /(...)/g;
> END { foreach $c (sort keys %cs) { $final .= "\"".uc($c)."\" = $cs{$c}, " }
> $final =~s/, $//; print "[$final]" }'
["AAA" = 1, "ATG" = 1, "CCC" = 1, "GGC" = 1, "GGG" = 1, "GTA" = 1, "TAA" = 1, "UUU" = 1]

[USER]

It is:

syntax error at -e line 2, near ">"
syntax error at -e line 3, near ""[$final]" }"
Execution of -e aborted due to compilation errors.

What do these errors mean? I can't see the exit/output...

[Jorge Amigo]

What I wrote in my comment was exacly what you could read on your screen, so the $ and the > characters at the beggining of each line are not meant to be copied and pasted. If you want to do so, then you have to copy and paste this:

echo "atguuucccggggtataaggcaaaa" | perl -ne '$cs{$1}++ while /(...)/g; END {
foreach $c (sort keys %cs) { $final .= "\"".uc($c)."\" = $cs{$c}, " }
$final =~ s/, $//; print "[$final]" }'

[USER]

Thanks! ;)

[USER]

Can you give me a hint of what I'm doing wrong? Or what can I do or study to fix it? What should I learn?

Answer 2

[Jorge Amigo]

As Devon says, you don't need that equation to count exons. If the fasta sequence is serialized, you can just use this perl oneliner:

echo "atgatggtagtacatcatcat" | perl -lne '$cs{$1}++ while /(...)/g;
END { foreach $c (sort keys %cs) { print uc($c).": $cs{$c}"  } }'