bowtie2 making new indices

Question

[amitpande74]

Hi, I have a sequence which includes a transposon along with a gRNA

>TE
TGTATGTAAACTTCCGACTTCAACTGTA

I want to find this in my sample fastq files. I made an index using Bowtie2:

bowtie2-build /home/usr/Desktop/client/TE_pattern.fna TE_human

then aligned the sample fastq files to it:

bowtie2 -x /home/usr/sb_human -1 1.fq.gz -2 2.fq.gz --sensitive-local -S TE_align.sam

I can see the transposon in the SAM file , but since the pattern I had put contains the header >TE, now I cannot do anything for downstream processing as they do not contain the typical BED like format (bamtobed) to facilitate extraction of the genomic intervals. How do I build an index which can facilitate this? Kindly advise. regards.

[GenoMax]

I want to find this in my sample fastq files.

Are you simply interested in finding reads that contain this sequence or are you looking to identify locations where this transposon has inserted itself?

[amitpande74]

Primarily the genomic locations where the transposon has inserted