Extraction of nt bases from sequence

Question

[GP]

Hi All,

I have a fasta file containing approx 600bp long reads. I want to extract first 12 bases from each read along with fasta header and write into new file, is there any one liner or easy way to do this job? Any help is appreciated. Thanks!

Answer 1

[iraun]

Assuming that your fasta file has only one line per sequence, you can use this awk command:

awk '{if ($1 ~ />/) {print}else{print substr ($0, 0, 12)}}' file.fa

[5heikki]

Or if the headers are ≤ 12 characters then simply

cut -c1-12 file > out

And if it's multiline (same header restriction):

cut -c1-12 file | grep -A1 "^>" | grep -v "^-" > out

[GP]

Header is > 12 characters, thanks though, works as well!

[GP]

Thanks very much airan, its working. Actually I had multline fasta seqs that I formatted to single line, is there any tweaking in your one liner awk command to use it for multiline fasta file. Best, D

[iraun]

Glad to help :). If you have a multiline fasta file, I guess that you could use this one:

awk '/^>/{print;getline;print substr ($0, 0, 12)}' file.fa

[GP]

Perfect!! again, thanks :-)

[Explorer]

I am trying this code for a big file. Just as an example first 4 sequences, each 30000 nucleotide

When I try the following code, it works.

awk '/^>/{print;getline;print substr ($0, 20, 25)}' NCBIaligned.fasta > out.fasta

>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome
ccaggtaacaaaccaaccaactttc
>MW476548.1 |Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/UT-UPHL-2101350191/2020, complete genome
ccaggtaacaaaccaaccaactttc
>MW476562.1 |Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/UT-UPHL-2101876696/2020, complete genome
ccaggtaacaaaccaaccaactttc
>MW476590.1 |Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/UT-UPHL-2101037291/2020, complete genome
ccaggtaacaaaccaaccaactttc

However, for the position of more than 1000, it does not work and there is not sequence.

awk '/^>/{print;getline;print substr ($0, 28888, 25)}' NCBIaligned.fasta > out.fasta

>NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome

>MW476548.1 |Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/UT-UPHL-2101350191/2020, complete genome

>MW476562.1 |Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/UT-UPHL-2101876696/2020, complete genome

>MW476590.1 |Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/UT-UPHL-2101037291/2020, complete genome