What Is A Typical Quality Cutoff When Trimming Rnaseq Data?

Question

[camelbbs]

HI I want to ask a question about trimming rnaseq.

By fastqc, i got result of sequence quality and i don't what is usual cutoff for trimming. I see the end 100-101 is lower than 20.

There are three regions of score: 0-20, 20-28, 28-40, any general cutoff for this? Is ok to cut to 95bp.

And my pairend reads are not the same length. left-end is 101 and right end is 121. is that ok for analysis? do i need to cut the 121 to 95 or else?

Thanks a lot!!

Answer 1

[Arun]

Usually, in Casava >=1.8 format, I look for consecutive set of bases, for each read, with quality "#". This is similar to the "B" in older formats. For example:

@HWI-ST863:108:C0F9BACXX:8:1101:1235:1979
CTTACTAAAGACAATGGTGTTCTTCTCATCTTCGATGAAGTCATGACTGGATTTCGTCTAGCCTATGGTGGAGCCCAAGAATACTTTGGAATCACGC
+1:N:0:ATCACG
CCCFFFEFHHHHHJJJJFEIIJJJGHIJJHIJJJIJJIEHIIIJIIJIJJGIIIJHIGH######################################

I trim to obtain:

@HWI-ST863:108:C0F9BACXX:8:1101:1235:1979
CTTACTAAAGACAATGGTGTTCTTCTCATCTTCGATGAAGTCATGACTGGATTTCGTCT
+1:N:0:ATCACG
CCCFFFEFHHHHHJJJJFEIIJJJGHIJJHIJJJIJJIEHIIIJIIJIJJGIIIJHIGH

This has resulted in an average quality >= 30 for all my fastq files. When I mean average, its not per read, rather, the average quality at each base over all reads. If the trimmed sequence length is > a threshold ( 60 for 100 base reads in my case), then I keep them. Otherwise, I discard them. Just to give an idea. This can be done separately for both pairs. If one of the pairs gets discarded while trimming for quality, then I keep the other as a single end read in a separate file. After quality trimming, I balance the pairs so that each pair is on the same line between the 2 fastq files. However, I don't understand how/why the paired end reads are of different lengths.

[Sean Davis]

Note that trimming "#" from Illumina reads is not the same as trim for average quality>=30.

[Arun]

True, I have modified my reply. Thank you Sean.

[camelbbs]

Thanks! My pair-end reads are really in different length. 101 and 121. Does that affect the analysis?

Answer 2

[Sean Davis]

Trimming based on length is probably going to be less than optimal since you will likely end up cutting off some high-quality bases in some reads and leaving low-quality bases in others. I'd suggest using any one of a dozen or more trimming softwares (cutadapt, fastx, sickle, trimmomatic) to do the quality trimming based on individual read base qualities.