Question

Short-Read Assembly No Reference Sequence

0

Entering edit mode

11.7 years ago

2011101101 ▴ 110

I have small rna data to assembly,there is no reference sequence .the length is18-28nt.

The result like the result of cap3 . Like this

>1
ACCTTTTTTTTTTACCCCT
>2
CTTTTTTTTTTACCCCTACAC

Result

>contig1  
ACCTTTTTTTTTTACCCCTACAC

which program is better?

assembly • 2.6k views

ADD COMMENT • link updated 3.8 years ago by Biostar 20 • written 11.7 years ago by 2011101101 ▴ 110

2

Entering edit mode

You will have to improve this question to get an answer. "Which soft is better" does not make sense. What is "soft"?

ADD REPLY • link 11.7 years ago by Neilfws 49k

0

Entering edit mode

your reads are shorter than 28nt?

ADD REPLY • link 11.7 years ago by Ido Tamir 5.2k

0

Entering edit mode

reads from short rna libraries often contain a very high percentage of adapter sequence, so in case you were running 36bp protocol it's not surprising to end up with 18-28bp soft-trimmed reads

ADD REPLY • link 11.7 years ago by Sebastian Kurscheid ▴ 300

0

Entering edit mode

Yes,the clean reads.

ADD REPLY • link 11.7 years ago by 2011101101 ▴ 110

score 1 · Answer 1 · 2013-02-26

1

Entering edit mode

11.7 years ago

Andreas ★ 2.5k

You might want to start by having a look at this pretty exhaustive comparison, which is based on Fonseca et al. (2012) but up-to-date.

Andreas

ADD COMMENT • link 11.7 years ago by Andreas ★ 2.5k

0

Entering edit mode

He says he has no reference genome and your second link points to a paper comparing mapping tools that require a reference. The first link seems to be broken.

ADD REPLY • link 3.8 years ago by juanjo75es ▴ 130

score 0 · Answer 2 · 2013-02-26

One possibility is to do de novo assembly of your very short reads with Pinball:
https://github.com/avilella/pinball/wiki

If you want to skip installation and set up, you can try the virtual machine here:
ftp://ftp.ebi.ac.uk/pub/databases/ensembl/avilella/pinball/PinballVM.1.0.4.ova
The installation procedure of the virtual machine is the same as described here:
http://www.ensembl.org/info/data/virtual_machine.html

Hope it helps.