How To Submit Taxon Id When Submitting Sequences To Genbank With Sequin?

Question

[John]

Hi,

I'm submitting some sequences to Genbank using the Sequin desktop tool. I want to include the Taxon ID in my FASTA header so that Sequin recognizes it. Here is my example:

>my_seq_id_12353 [Organism=Mus musculus] [Strain=musculus] [country=USA] [taxon=39442] title of my submission
ggcggacgggtgagtaacgcgtgagaatcagccttcaggatggggataacagagggaaaccgct

Every works except the taxon part, which is a field that it does not recognize. Any thoughts, or any comments on the better way to submit to Genbank?

Thanks, John

Answer 1

[Chris Evelo]

I have never done that. But is says this at NCBI:

Performing a Taxonomy lookup

A taxonomy lookup is performed by the NCBI database staff after the record has been submitted to GenBank. Using Sequin in its network-aware mode, interested users can themselves look up the taxonomic lineage of the organism from which the sequence is derived. Taxonomy lookups are performed through the NCBI's taxonomy database. If the taxonomy lookup fails for the organism from which your sequence is derived, please consult the taxonomy WWW page. If your organism is not listed, or if you disagree with the lineage we have specified, please make sure to include as much information as possible along with your submission to help our taxonomy staff place the new species in our taxonomic database.

Doesn't that mean that they will try to derive the taxon from the data and you don't have to supply it?

[John]

Many thanks. Such a weird way to go about it. I'd think that I'm in a better position to know what organism I'm submitting, obviously not. :)