What Is The Input Format For Rnaplot In The Vienna Package?

Question

[cacaucenturion]

Hi all,

I am going to use RNAplot (in Vienna RNA package) to draw a figure of my RNA secondary structure. I however, I do not know what should be the input. Could anyone please tell me? Thanks!

Answer 1

[Giovanni M Dall'Olio]

Here is an example of RNAplot's input format:

>seq1
ACTGAGCTTAGCGATTAGGC
(((..((((...)))).)))

This format is known as "dot-bracket notation", and it is used to represent a RNA secundary structure by many other packages, and is also used by many Vienna scripts. I can not find much documentation online, but here there is some.

Note that you can calculate this structure by using the RNAfold tool:

$: echo ">seq1" > myseq.txt
$: echo "ACTGAGCTTAGCGATTAGGC" >> myseq.txt
$: cat myseq.txt
>seq1
ACTGAGCTTAGCGATTAGGC

$: cat myseq.txt | RNAfold > myfold.txt
$: cat myfold.txt
>seq1
ACUGAGCUUAGCGAUUAGGC
.....(((((.....))))) ( -2.70)

# Note: to use RNAplot, you have to remove the score first:
$: sed -i 's/ \(.*\)$//' myfold.txt
$: cat myfold.txt
>seq1
ACUGAGCUUAGCGAUUAGGC
.....(((((.....)))))

Once you have the input file, you can produce the plot by simply calling RNAplot:

cat myfold.txt | RNAplot -o svg

[cacaucenturion]

Thanks very much!!!!!!

Answer 2

[Nicolas Rosewick]

http://www.tbi.univie.ac.at/~ronny/RNA/RNAplot.html

RNAplot 2.1.1

Draw RNA Secondary Structures

The program reads RNA sequences and structures from stdin in the format as produced by RNAfold and produces drawings of the secondary structure graph.

[cacaucenturion]

Thanks !a lot for your help