What Is The Actual Illumina Smallrna Seq 3' Adapter

Question

[Bharat Iyengar]

This is the sequence of illumina small RNA seq 3' adapter as reported everywhere:

TCGTATGCCGTCTTCTGCTTGT

if i trim this adapter only 0.2% of all the reads are trimmed.

Just by casual observation I noticed that the sequence "TGTAGGCACCA" is present in the 3' of 50% of the reads. It is not the case with another sample.

Is there a standard adapter sequence? If not then is there a tool for finding any unknown adapter? biopieces find_adaptor doesnt look for all kinds of possible adapters.

Answer 1

[Rm]

Check the Kit you used for library preparation; We have "TGGAATTCTCGGGTGCCAAGG" as 3prime adapter sequence. Did you tried fastx tool kit for adapter clipping (fastx_clipper)?

[Bharat Iyengar]

this is not my data.. i am doing analysis of a data which i downloaded from SRA.. yes I was using fastx_clipper, but the adapters vary from sample to sample..

Answer 2

[oweitu]

This is quite late but may be of use to someone like me down the road.

Eurofins published a list of adapters so maybe you can input the relevant ones into your trimming program; http://www.eurofinsgenomics.eu/media/1610545/illumina-adapter-sequences.pdf

Best of luck.