Post Assembly Gap Filling

Question

[HG]

Hi every one i am doing some plamid genome assembly with spades. After assembly i used SSPACE for scaffolding. But there are some gap each of the draft genome. I can fill the gap by PCR. But i want to reduce the number of gap insilico?? Can anyone suggest how to reduce the gap ?? If i do mapping the reads with contigs will it be give any promising result???

[GR]

I used finishing scripts for my work on sequencing of mitochondrial genome. Hope this will be useful for you as well. http://www.cbcb.umd.edu/finishing/

[appiahv]

Hello @Boetsi

I used SSPACE-STANDARD to generate scaffold of my Salmonella typhi draft assembly. The only 'N' I found was on one contig as shown TAGAGAACCCTTCAATTGTTACGACAGGTCCAAATACTTCTTCTTGTACAATNCTCATAG

Is it still necessary for me to do gap filling?

[Ram]

Please do not add answers unless you're answering the top level question. I'm moving your "answer" to a comment.

Answer 1

[martenboetzer2]

There are a few in silico tools that can fill in the gaps within scaffolds;

GapFiller (developed by myself, I'm also the developer of SSPACE): http://www.baseclear.com/landingpages/basetools-a-wide-range-of-bioinformatics-solutions/gapfiller/ http://genomebiology.com/2012/13/6/R56

IMAGE2: http://sourceforge.net/apps/mediawiki/image2/index.php?title=Main_Page

GapCloser (part of SOAP): http://sourceforge.net/projects/soapdenovo2/files/GapCloser/

Regards, Boetsie

[larvalanobium]

Dear Boetsie

I've tried all three of the above programs, for GapCloser and IMAGE, report files indicated that no gaps are filled and Gap filler hangs then crashes on the first iteration. My assembly is Eukarytic, built with SPAdes, using PE and Minion reads. I am doing the gap closing with same PE reads used to assemble the genome. Is this why gap closing is failing? Are we supposed to use a different read library for the gap closing?

Thanks and kind regards Crystal

Answer 2

[Biojl]

If you use paired reads you can take a look to: GapFiller

I haven't test it myself, though.

Answer 3

[Leszek]

GapCloser from SOAPdenono works perfect for me.
To use it, you will need paired-end or mate-pair reads.

[HG]

To run GapCloser from SOAP denovo , is it necessary to assemble with Soap denovo?? or else i can use different assembler. After that i can upload reads and contig ??? Currently i am using Spades 2.5.1

[Leszek]

no, as described in the program manual, you need assembly in fasta, reads in fastq or fasta and config file

Answer 4

[Adrian Pelin]

Your genome is circular, correct?

Your current assembly resulted in the entire genome as a scaffold with gaps (NNNs), but otherwise, your scaffold is circular, correct?

You can try iterative read mapping. You can do that either with CONSED (free) or Geneious (14 day free trial). When you map iteratively, each time an iteration is complete, the idea is that your contigs will be extended slightly. At one point, they should overlap. The bigger the read lengths, the faster you will be done.

[Lee Katz]

This is IMAGE2's strategy. See martenboetzer2's (Boetsie's) answer.