Finding Adapters For Illumina Reads

Question

[figo]

Hi All

I have some illumina reads but I don't know which adapters has been used. How I can find if my illumina reads has adapters and of which type.

Best

[xiaojuhu13]

hi, I have the same problems, how do you resolve it?

Answer 1

[Phil S.]

Hi,

imprt them into the FastQC program. Go for "overrepresented sequences" there should be stated which adaptors are used.

[gammyknee]

That will only happen if there is adapter contamination. Usually that is not the case, as people always try and sequence a fragment longer than the read length

Answer 2

[rtliu]

FastQC only gave you warning when overrepresented sequences were in first 200,000 sequences. see FastQC documentation

Supposed read1.fastq and read2.fastq is the paired end data with 4 lines per read.

Download common Illumina adapters from https://github.com/vsbuffalo/scythe/blob/master/illumina_adapters.fa

Go through each adapter, e.g. sampling 1 million read1.fastq for truseq-forward-contam adapter:

cat read1.fastq | head -4000000 | grep AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC | wc -l 
cat read1.fastq | tail -4000000 | grep AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC | wc -l

If the above command output >100, then sampling 1 million read2.fastq for truseq-reverse-contam will output with similar number:

cat read2.fastq | head -4000000 | grep AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA| wc -l 
cat read2.fastq | tail -4000000 | grep AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA| wc -l

[Phil S.]

no need for cat imho:

head -4000000 read1.fastq | grep AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC | wc -l

Answer 3

[rse]

In reference to the comment above, i tried the following commands:

cat read1.fastq | head -4000000 | grep <Adaptersequence> | wc -l 
cat read1.fastq | tail -4000000 | grep <Adaptersequence> | wc -l

on my fastq file and got different output numbers (2731 and 1818 respectively).

What does this signify?

[Adrian Pelin]

Means your forward reads have 2731 adapters in them and reverse have 1818. The numbers do not have to be identical.

Answer 4

[Irsan]

You can find the illumina adapters on the illumina website.

[lxu16]

The link doesn't work.