How To Modify Contig Format:

Question

[HG]

Hi everyone I need co change a contig file format : can any one help me out using awk or perl

Input file:

>NODE_411_length_76_cov_325.381_ID_5152754
AAGAAGCAAATAtAAACAGCATTAAAGATATACACATAAAAATGAAGTACTAAA
>NODE_412_length_75_cov_54.1_ID_5146650
CCCTAAATTGAGAAAATAACTTTAGGGAATATATCAATGTACAGTGCCCGCTTCGTTAT
>NODE_413_length_74_cov_63.8947_ID_373286
GTATTGATCCAAAATCGGTGTAAATATTACCCTTTTTAGGTGTATTAGGTGTTAAATGTA

Out put should be like :

>Contig0.1
AAGAAGCAAATtAtAAACtAGCATTAAAGATATACACATAAAAATGAAGTACTAAA    
>Contig0.2
CCCTAAATTGAGAAAAaTAACTTTAGGGAATATATCAATGTACAGTGCCCGCTTCGTTAT
>Contig0.3
GTATTGATCCAAAATCGGTGTAAATATTACCCTTTTTAGGTGTATTAGGTGTTAAATGTA

Thank you advance .

[Michael]

Your output format is awkward, why would you want that? It's not even fasta format because of the extra whitespace before >. What do you need the extra line break for? Please be more specific about what you want to change, as your examples do not match each other.

[Devon Ryan]

Do you just need the names ("NODE_411...", etc.) changed or is something supposed to be done with the sequences as well? How are we to know what bases should be made lower case or is that already done? I have a feeling that you don't actually know what you would like to do (you're certainly not providing enough information for anyone to help you).

[HG]

Hello, i have modify the above question please have a look.

Answer 1

[Devon Ryan]

Given the update:

awk 'BEGIN{i=1; OFS=""}{if(substr($0,1,1) == ">") { print ">Contig0.",i; i+=1}else{print $0}}' foo.fa

[Kenosis]

Another awk option:

awk '{/^>/ && sub(/>.+/,">Contig0."++i); print}' foo.fa

[Devon Ryan]

Nice, that's rather more concise than mine!

[HG]

Thank you so much . Its working fine.

Answer 2

[Kenosis]

With Perl:

perl -lne 's/^>.+/">Contig0.".++$i/e;print' foo.fa