Blast The Sequences Obtained From Translocations To Get Their Positions

Question

[ancient_learner]

HI I have a file that contains information like this:

Gene1 Gene2 sequence 
FOXP1    ABL1    acacctctcaatgcagctttacagCtctacgtctcctccgagagccgctgtggagagttacgtcgaaatgtc
 FUS    ATF1    TATGGACAGCAGAACCAGTACAACAGCAGCAGTGGTGGTGGAGGTGGAGGTGGAGGTGGAGTTGCCATTGCCCCAAATGGAGCCTTACAGTTGGCAAGTCCAGGCACAGATGGAGTACA
 FUS    CREB3L1    ttgagtctgtggctgattacttcaagcagattgGctctctgcccccctccagccctgtcaggcccatg
 FUS    CREB3L1    TATGGACAGCAGGACCGTGGAGGCCGCGcCACGGCCATCTCCACCTCCCCACTCCTCACTGCCCCTCACAAA

These genes are known to be involved in the translocation and the sequence contains part of Gene1 and part of Gene2. for example the sequence acacctctcaatgcagctttacagCtctacgtct belongs to FOXP1 and cctccgagagccgctgtggagagttacgtcgaaatgtc might belong to ABL1.

I have thousands of such sequences and i want to exacly locate where in the gene that translocation occurs i,e., the genomic positions where that part of the sequence belongs

   gene1   genomic_position       translocation_occurs         gene2   genomic_position       translocation_occurs
   FOXP1 chr6:98925342-99435345 chr6:98925380-chr6:98925414   ABL1 chr2:31688556-31804227 chr2:31688756 31688794

How can i get such information i have thousands of such sequences

Answer 1

[jackuser1979]

You can make use of BLAT tool available in UCSC Genome Browser website.

[ancient_learner]

Thankyou very much. completely forgot the blat tool. one more doubt: There is a limit on how many sequences to be given as input in the web server is there any alternative for that? i mean my sequences are huge

[jackuser1979]

You can download the Blat to your local machine. For more information see: http://genome.ucsc.edu/FAQ/FAQblat.html#blat3 PS. If you think your question is answered, pl don't forget to accept the answer.

[ancient_learner]

I have accepted your answers twice :)