Entering edit mode
10.9 years ago
akhattri
▴
50
hi there, I am also getting this error while running VFS (http://sourceforge.net/projects/viralfusionseq/) (VERSION: Revision 1250) on CentOS 5 release 5.10 (Final) system. After this error SSAKE also fails. Please let me know how this can be fixed. The portions of error output are below. Thanks for the help.
Error 1
Hashing CL7R_1_VFS.dynamic.min35.fq.gz
Hashing CL7R_2_VFS.dynamic.min35.fq.gz
Use of uninitialized value in concatenation (.) or string at
/data3/users/arun/Apps/vfs/include/RPmethod.pm line 268 (#1)
(W uninitialized) An undefined value was used as if it were already
defined. It was interpreted as a "" or a 0, but maybe it was a mistake.
To suppress this warning assign a defined value to your variables.
To help you figure out what was undefined, perl tells you what operation
you used the undefined value in. Note, however, that perl optimizes your
program and the operation displayed in the warning may not necessarily
appear literally in your program. For example, "that $foo" is
usually optimized into "that " . $foo, and the warning will refer to
the concatenation (.) operator, even though there is no . in your
program.
Hashing vfs_dev.HKCI5a.4h_map.fq
Entering Essential::tx_targeted_assembly.
Skipped Insert Size estimation. Supplied insert size: 350
Essential::ssake_reads_prep
Assuming fasta file
Hashing vfs_dev.HKCI5a.RPm.out_2.fa
Processing vfs_dev.HKCI5a.RPm.out_1.fa and vfs_dev.HKCI5a.RPm.out_2.fa
Use of uninitialized value in pattern match (m//) at
/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 2 (#1)
Use of uninitialized value in concatenation (.) or string at
/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 2 (#1)
Use of uninitialized value in pattern match (m//) at
/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 4 (#1)
Use of uninitialized value in concatenation (.) or string at
/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 4 (#1)
--------------continued to even no of lines (6,8,10,12,14.....)--------------
/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 38 (#1)
Use of uninitialized value in concatenation (.) or string at
/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 38 (#1)
Error 2: SSAKE
Running: /data3/users/arun/Apps/ssake_v3-8/SSAKE [v3.8]
-f vfs_dev.HKCI5a.RPm.plus.vicinity.CS_FnR.ssake.in
-s vfs_dev.HKCI5a.CSm.out.fullread.fa
-i 0
-h 0
-w 1
-m 20
-o 3
-r 0.9
-t 0
-z 100
-p 1
-e 0.75
-k 4
-a 0.5
-x 20
Unpaired reads (optional) -g no-g
Scaffolds: vfs_dev.HKCI5a.targeted.assembly.sensitive.scaffolds
Merged contigs: vfs_dev.HKCI5a.targeted.assembly.sensitive.mergedcontigs
Pairing issues: vfs_dev.HKCI5a.targeted.assembly.sensitive.pairing_issues
Pairing distance distribution: vfs_dev.HKCI5a.targeted.assembly.sensitive.pairing_distribution.csv
Contigs: vfs_dev.HKCI5a.targeted.assembly.sensitive.contigs
Singlets: vfs_dev.HKCI5a.targeted.assembly.sensitive.singlets
Excluded reads: vfs_dev.HKCI5a.targeted.assembly.sensitive.short
Log: vfs_dev.HKCI5a.targeted.assembly.sensitive.log
=>Reading sequences initiated Thu Jan 2 14:45:44 CST 2014
Sequence reads loaded:
616Input error at line #618: The sequence "0:" is not in the right format for paired-end reads -- Fatal
Make sure your input is in the form (input sequences can be of variable lengths):
>test
GCTACGACTATGACATACAGT:GTAGATTGATCGCATGCACGCT
Where : separates paired reads. Spaces, <<.>> or any characters other than A,C,G or T in your input file might have caused this error, including reads with Ns.
mv: cannot stat `vfs_dev.HKCI5a_temp/*.targeted.*.contigs': No such file or directory
Number of log files deleted: 0
