Do I need to download any specific adapters for Illumina small RNA sequencing kit?

Question

[bioinforesearchquestions]

Hi Friends,

Recently we sequenced small RNA sequencing using Rapid Run platform. As the size of the small RNA ranges between 18 to 35bases. The reads from this run would have bases sequenced from the adapters and primers. I am planning to trim off the adapters and primers.

I am currently using Trimmomatic tool for trimming process. Along with the tool, I have a list of adapters in FASTA format. Within Trimmomatic tool, there is a folder named "Adapters". It has following files

• Illumina_Adapter_Full.txt
• IlluminaAdapter-PE.fa
• Illumina-MultiplexingPrimer.fa
• Illumina-SmallRNAAdapter.fa
• Illumina-TruSeqAdapter.fa
• NexteraPE-PE.fa
• TruSeq2-PE.fa
• TruSeq2-SE.fa
• TruSeq3-PE-2.fa
• TruSeq3-PE.fa
• TruSeq3-SE.fa

In my case, I used "Illumina-SmallRNAAdapter.fa" and "Illumina-MultiplexingPrimer.fa" for trimming the reads.

Illumina-SmallRNAAdapter.fa

RNA 3 Adapter TGGAATTCTCGGGTGCCAAGG

Do I need download any specific adapters for Illumina small RNA sequencing kit?

[CHINMAYA]

Illumina_Adapter_Full.txt IlluminaAdapter-PE.fa Illumina-MultiplexingPrimer.fa Illumina-SmallRNAAdapter.fa Illumina-TruSeqAdapter.fa

can any one provide these files link?

[GenoMax]

Files currently include with trimmomatic should cover all necessary Illumina adapters.

With small RNA kits there may be a kit specific adapter sequence so you should always check which kit was used and follow data processing instructions (if provided).

Answer 1

[swbarnes2]

Just use fastqc to see if you even have any adapters that need trimming, and if you do, it will tell you what sequences you need to remove.