Remove whitespaces on fasta files, except on fasta-header

Question

[genomes_and_MGEs]

Hey everyone,

I have a multi-fasta file like this:

>NC_000914 464618..534825
gtgccttccattttggagcgggaccaaatcgcagcggttctggtaagtgcgagcagggac gtgccttccattttggagcgggaccaaatcgcagcggttctggtaagtgcgagcagggac
aaaacgccggccggcttgcgggaccatgcgatattacaactgctcgccacctacggactg aaaacgccggccggcttgcgggaccatgcgatattacaactgctcgccacctacggactg
cgatcaggagaaatccgcaacatgcggattgaggatatcgattggcggaccgaaaccatt cgatcaggagaaatccgcaacatgcggattgaggatatcgattggcggaccgaaaccatt

I would like to remove whitespaces from the fasta sequences, but keep the whitespaces on the fasta-headers (>). I use this command sed -i '/^>/ s/ .*//' file.fasta to remove whitespaces from fastaheaders, but now I want the opposite. Is this possible?

Thanks!

[cpad0112]

negate the headers in current command line. But be careful while using i and current commandline is not correct to remove only spaces in header.

[genomes_and_MGEs]

Thank you for the reply. But how to negate that? Yes, I'll be careful with -i, thanks for the tip

[cpad0112]

/^>/! and current commandline removes space and any thing after that. Do not use that for this purpose. Try this: sed '/^>/! s/\s\+//g' test.fa