NGS raw data manipulation using Linux/Unix

Question

[rijithraj]

Hi,

I wanna add sample ID along with read IDs in my NGS data using unix platform. Can anyone help me with this?

Thanks in advance

Rijith Jayarajan

[GenoMax]

add sample ID along with read IDs

Add exactly where? If in fastq header, that would break the Illumina sequence identifier format.

[5heikki]

If you go from:

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

to:

@SEQ_ID;SAMPLE_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

How would that break the header format?

[GenoMax]

I meant to say Illumina sequence identifier format. Amended above.

[5heikki]

I mostly deal with Ion Torrent reads. Are there any programs that would stop working properly if Illumina read headers were modified by the user?

Answer 1

[swbarnes2]

This is...uncommon. Usually each fastq files name indicates its sample name, or you can add sample ID to the read group info in a bam, but for many applications, again, the sample name can be indicated in the bam name.