how to split RNA-seq into codons by using python

Question

[m90]

I have this RNA-seq ACAGUCGACUAGCUUGCACGUAC and I want to split it into codons like this (ACC and AGG) and count the number of complete codon and incomplete codon by using python?

Answer 1

[Istvan Albert]

Today I got access to a "new thing", currently in beta testing, called the GitHub Copilot, I am using it to answer this question:

first I typed

## how to split RNA-seq into codons

The copilot wrote me the code:

def codons(seq):
    codon_list = []
    for i in range(0, len(seq), 3):
        codon_list.append(seq[i:i+3])
    return codon_list

Let's see how it works:

seq = "ACAGUCGACUAGCUUGCACGUAC"
print (codons(seq))

prints:

['ACA', 'GUC', 'GAC', 'UAG', 'CUU', 'GCA', 'CGU', 'AC']

looks good to me, then I wrote:

#  count complete and incomplete codons

without batting an eye the Copilot suggested:

def count():
    seq = "ACAGUCGACUAGCUUGCACGUAC"
    codon_list = codons(seq)
    complete = 0
    incomplete = 0
    for codon in codon_list:
        if len(codon) == 3:
            complete += 1
        else:
            incomplete += 1
    return complete, incomplete

A new era has begun in computing.

I'll remember this day: Friday, October 29, 2021. It is the day when I realized a new era is upon us.

[cpad0112]

Really interesting project.

[Ram]

No more Google/StackOverflow middle-man then, just go to this site, type in your google query, get code to run. Nice!