Single end read adapter trimming via flexbar

Question

[iamsmor]

Hi guys I am beginner in sequence analysis.I am trying to trimming adapter because ı have seen that my data has adapters end of sequences according to multiqc result. Its is single end reads and ı have tried this commend in below for each fastq file

flexbar --adapters $RNA_REFS_DIR/illumina_multiplex.fa --zip-output GZ --reads $RNA_DATA_DIR/SRR309134.fastq --target $RNA_DATA_TRIM_DIR/SRR309134

and ı create file for adapter

>Multiplexing_Read_1_Sequencing_Primer_3_to_5
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
>Multiplexing_Read_2_Sequencing_Primer_3_to_5 
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>Single_end_Reads_Sequencing_Primer_3_to_5  
CTGTCTCTTATACACATCT

But it doesnt trim anything in sequences. and multiqc still shows adapter in same place and same lenght. Anyone has any idea how ı can trim it precisely??

[GenoMax]

Online help shows the following command line:

flexbar -r reads.fq -a adapters.fa -ao 3 -ae 0.1

Perhaps you need the options at the end for the program to work. Take a look at the manual/in-line help.

[iamsmor]

thank you. But I am guessing that the problem is the fact that ı couldnt choose the right adapter.