blastn a query to a masked subject

Question

[LDT]

Dear all,

I have a reference/subject that looks like this

CGAAGCTCTCCTACGNNNNNNNNNNNNNNNNNNNNNNNNNCAGTCCAGCGCC

and I want to blast on it multiple queries that look like this

>M01755:672:000000000-K43MP:1:1101:15627:1757 1:N:0:1
GGTCGAGGTCGGTGTAGCGTCGTAAGCTAATACGAAAATTAAAAATGACAAAATAGTTTGGAACTAGATTTCACTTATCTGTTTGTCGCTGGACTGACTGCACTGTTGTTTTTCATGAGAACGTAGGAGAGCTTCTTGGCCATCGGCCCAA

my intention is to reveal like this the masked area, NNNNNNNNNN, in the reference. It seems that blast does not like NNNNNNNN. Any idea?

[lieven.sterck]

you can consider to run blast with a custom made scoring matrix. This will require to dig a bit in the blast code but it is doable (I've done it myself in the past as we used to use a custom matrix in annotation purposes).

it would be custom as to include the N in it and give it a match score to any other nucleotide.

on the other hand I do also have the feeling there must be more appropriate tools than blast to do this (some regex matching perhaps? )