FASTA to Seurat Object

0

Entering edit mode

2.7 years ago

AbsaR • 0

I want to create seurat object from fasta files. I have illumina sequences, 2 .fasta files for each samples..... any pipeline to follow ?

data fasta seurat preprocessing • 1.4k views

ADD COMMENT • link 2.7 years ago by AbsaR • 0

0

Entering edit mode

I assume you mean fastq files? See Cell Ranger, alevin-fry, or STARsolo documentation.

ADD REPLY • link 2.7 years ago by rpolicastro 13k

0

Entering edit mode

i am using starsolo on galaxy but i am getting the following error

EXITING because of FATAL ERROR in input read file: the total length of barcode sequence is 100 not equal to expected 28 Read ID=>SRR2431431.1 ; Sequence=ACTTAAAGGAATGTGGGCTTTATTGAGAGGATGGCATAGTAAAAGCTATTACAGGGAGGAGTGTTGAGACCAGATGTCATCTACTGTCTCTTGGGTCAGC SOLUTION: check the formatting of input read files. If UMI+CB length is not equal to the barcode read length, specify barcode read length with --soloBarcodeReadLength To avoid checking of barcode read length, specify --soloBarcodeReadLength 0

Does it mean that the RNA seq data is not 10x Chromium ? How to solve this error ?

ADD REPLY • link 2.7 years ago by AbsaR • 0

0

Entering edit mode

for reference i am using E-GEOD-73121 dataset, and working with single cell rna seq of patients metastatic samples only

ADD REPLY • link 2.7 years ago by AbsaR • 0

Login before adding your answer.