Entering edit mode
2.6 years ago
antoinefelden
▴
60
Hi, I'm using blastn in BLAST 2.11.0 and it keeps failing for specific sequences for a reason that I'm yet to understand. Any lead on what he problem might be? The error message is
Error: NCBI C++ Exception:
T0 "/tmp/BLAST/2.11.0/gompi-2020b/ncbi-blast-2.11.0+-src/c++/src/serial/objistrasnb.cpp", line 499: Error: (CSerialException::eOverflow) byte 132: overflow error ( at [].[].gi)
T0 "/tmp/BLAST/2.11.0/gompi-2020b/ncbi-blast-2.11.0+-src/c++/src/serial/member.cpp", line 767: Error: (CSerialException::eOverflow) ncbi::CMemberInfoFunctions::ReadWithSetFlagMember() - error while reading seqid ( at Blast-def-line-set.[].[].seqid.[].[].gi)
Whenever that happens, BLAST stops and the job fails. By splitting the fasta file in individual sequences, I've managed to isolate two examples of sequences that work and don't. This sequence is fine:
>S11_66329
ACTTTGAGCAGGAATAATTGGAACATCTTTAAGATTAATAATTCGATTAGAGTTAGGAACACCATCATCACTTATTAACAATGATCAATTTTATAATTCTATTATTACAGCTCATGCTCTAGTAATAATTTTTTTTATAGTTATACCAATTATAATT
But this sequence produces the error:
>S11_66321
CATGTCTTATGCTATGGTAGTTTAACAGCAAGCGTTTACTTTTTTTAATGTGTAATTATAATTTCCATATGGTCTTATCAATTAAAAAACTTTTGTCATTGCTTGTCCAATGTAGGTCACTAAAATTGGTCGAGATGCAGTTCTGTATGTGGAGTCTTTGATTGAGTCTATTATGGGAGGATTGGAAGGGTTGATCAATATTCTGGATTCTGAT
Command ran is (with test.fna containing the two above sequences):
blastn -query test.fna -db /nfs/scratch/shared_spaces/blastdb/nt/nt_20220427/nt -out test -num_threads 8 -max_hsps 5 -max_target_seqs 1 -outfmt "6 qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore sscinames staxids"
Can you provide your command line? Which db are you blasting against? Local or remote at NCBI.
I've updated the question, cheers! I'm using a local indexed nt database.
I don't know the reason of the issue, but I recall having seen a similar question on Stack Overflow. I think, the newer version solved it...
Did you ever find a solution? I'm getting the same error code and am not sure what's wrong. Running blast+ 2.11.0 as well with a built-in database on a server.
If possible download the latest blast+ executable from https://ftp.ncbi.nih.gov/blast/executables/LATEST/