Extract sequence from Fasta using header

Question

[Princy]

Hello, I have a list of headers, I need to extract the sequence from the fasta file. how can I do it? kindly let me know.

The header file looks like this

>TRINITY_DN74691_c0_g1_i1
>TRINITY_DN74659_c0_g1_i1
>TRINITY_DN74659_c0_g1_i1
>TRINITY_DN74698_c0_g1_i1

fasta file looks like this

>TRINITY_DN74697_c0_g1_i1 len=243 path=[221:0-242] [-1, 221, -2]
GTATGTCCCACCAGACACAGCAGGGCTGGCAGGCCGAGTTTGAGTTTGGAATATATCTG

[GenoMax]

@princy: You have asked many questions on biostars over the last few months but appear not to have validated any of them. Accepting answers (you can accept multiple) using the green checkmark is appropriate way to provide closure to threads.

Answer 1

[GenoMax]

See: Filter fasta sequences based on a list with grep or BBmap

Answer 2

[lieven.sterck]

seqkit will be able to do this. (subprogram seq )

(alternative, if you have a blastdb of that fasta file, you can also get them by using blastdbcmd)