cutadapt output empty

Question

[fsaci]

This is my first time using cutadapt. After trimming adapter(AGATCGGAAGAGC) for SE 50bp sequencing reads file, I get a empty fastq file.

My command is :

cutadapt -a AGATCGGAAGAGC -o results/sRNA-seq/cutadapt/SRR8857862_cutadapt.fq.gz fastq/SRR8857862.fastq.gz

The SRR8857862.fastq.gz file like this(I added the space manually to make it easier to view ):

$ zcat fastq/SRR8857862.fastq.gz | head | grep 'AGATCGGAAGAGC'
NACGACTCTCGGCAACGGATATCTCGG AGATCGGAAGAGC ACACGTCTGA
CATCCGTCTGGCTCAGTCTCCGTC AGATCGGAAGAGC ACACGTCTGAACT
NAATGACGGTATCTGAGG AGATCGGAAGAGC ACACGTCTGAACTCCAGTC

And the log infomation like this（I honestly don't understand this log file）:

$ cat logs/sRNA-seq/cutadapt/SRR8857862.log
This is cutadapt 4.1 with Python 3.7.12
Command line parameters: -a AGATCGGAAGAGC -o /results/sRNA-seq/cutadapt/SRR8857862_cutadapt.fq.gz /fastq/SRR8857862.fastq.gz
Processing single-end reads on 1 core ...
Finished in 200.24 s (9 µs/read; 6.39 M reads/minute).

=== Summary ===

Total reads processed:              21,331,325
Reads with adapters:                21,308,998 (99.9%)
Reads written (passing filters):    21,331,325 (100.0%)

Total basepairs processed: 1,066,566,250 bp
Total written (filtered):    515,957,093 bp (48.4%)

=== Adapter 1 ===

Sequence: AGATCGGAAGAGC; Type: regular 3'; Length: 13; Trimmed: 21308998 times

Minimum overlap: 3
No. of allowed errors:
1-9 bp: 0; 10-13 bp: 1

Bases preceding removed adapters:
  A: 18.4%
  C: 32.3%
  G: 19.3%
  T: 29.8%
  none/other: 0.1%

Overview of removed sequences
length  count   expect  max.err error counts
3       5       333302.0        0       5
4       1       83325.5 0       1
5       3       20831.4 0       3
7       3       1302.0  0       3
8       285645  325.5   0       285645
9       324846  81.4    0       324846
10      324158  20.3    1       315149 9009
11      317739  5.1     1       308296 9443
12      339889  1.3     1       329897 9992
13      376530  0.3     1       363714 12816
14      616486  0.3     1       596496 19990
15      574232  0.3     1       555528 18704
16      447063  0.3     1       432057 15006
17      500524  0.3     1       483221 17303
18      560586  0.3     1       540318 20268
19      543647  0.3     1       524023 19624
20      567565  0.3     1       545604 21961
21      516139  0.3     1       496017 20122
22      485929  0.3     1       466629 19300
23      590731  0.3     1       566924 23807
24      622773  0.3     1       596992 25781
25      623838  0.3     1       597729 26109
26      1625645 0.3     1       1558914 66731
27      789641  0.3     1       756910 32731
28      1150502 0.3     1       1103410 47092
29      1113779 0.3     1       1068052 45727
30      964253  0.3     1       924660 39593
31      1557766 0.3     1       1495846 61920
32      855010  0.3     1       820559 34451
33      584719  0.3     1       561147 23572
34      1042349 0.3     1       1001130 41219
35      274674  0.3     1       263732 10942
36      162642  0.3     1       156046 6596
37      2205326 0.3     1       2118110 87216
38      124374  0.3     1       118927 5447
39      57080   0.3     1       54734 2346
40      45116   0.3     1       43224 1892
41      30882   0.3     1       29671 1211
42      24274   0.3     1       23263 1011
43      21146   0.3     1       20289 857
44      17075   0.3     1       16332 743
45      5836    0.3     1       5595 241
46      2916    0.3     1       2792 124
47      1738    0.3     1       1656 82
48      1416    0.3     1       1363 53
49      1669    0.3     1       1593 76
50      30838   0.3     1       29419 1419

Thanks in advance!

[Asaf]

According to the log file it found the primer in almost all of the sequences and wrote them to the output file, are you sure it's empty?

[fsaci]

First of all, thank you very much for your reply.

I found that the file had been rewritten due to a problem with my subsequent analysis.

So I've solved the problem.