Entering edit mode
2.6 years ago
bioinfo223
▴
10
Hello, I need to filter this fasta file, on the basis of len mentioned in the header of the fasta file, I need less than equal to 100 len. I am new to bioinformatics, please let me know the one-line command for this.
>CM0 len:16 (+),score=7.52 CM040936.1:11567243-11571 523:2589-2636(+)
ATGGCATTAGTTCTGGCAGGTCACGTGAGTCAAGCTCGCATCAGCTGA
Thank you.
duplicate of How To Filter Multi Fasta By Length?? ; FASTA file of fixed length ; Fasta Length ;