Filtering a VCF by "IMP" flag in INFO with bcftools

Question

[Vanish007]

Hi,

I have a vcf file that has imputed markers after being phased through BEAGLE. I wanted to filter those SNPs and samples that have the imputed flag.

Through the header, I see the following:

##INFO=<ID=IMP,Number=0,Type=Flag,Description="Imputed marker">
#CHROM  POS     ID             REF     ALT     QUAL    FILTER  INFO    FORMAT
1       10177   rs367896724     A       AC      .       PASS    DR2=0.10;AF=0.3848;IMP;CSQ=C

I've trying the following commands:

$ bcftools view -i "INFO/IMP' myphased.vcf > Imputed_VCF.vcf

and it runs for a VERY long time without really outputting anything.

Trying it out as a head:

$ bcftools view -i 'INFO/IMP' myphased.vcf | head -10

Just gives the following:

 ##fileformat=VCFv4.2
 ##FILTER=<ID=PASS,Description="All filters passed">
 ##filedate=20220124
 ##source="beagle.28Jun21.220.jar"
 ##INFO=<ID=AF,Number=A,Type=Float,Description="Estimated ALT Allele Frequencies">
 ##INFO=<ID=DR2,Number=A,Type=Float,Description="Dosage R-Squared: estimated squared correlation between estimated REF dose [P(RA) + 2*P(RR)] and true REF dose">
 ##INFO=<ID=IMP,Number=0,Type=Flag,Description="Imputed marker">
 ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
 ##FORMAT=<ID=DS,Number=A,Type=Float,Description="estimated ALT dose [P(RA) + 2*P(AA)]"> 
 ##contig=<ID=1>

The same output occurs if I try

  $ bcftools view -i 'INFO/IMP=1' myphased.vcf | head -10

Running a "grep" expression for "IMP" does give me what I need, but not formatted correctly and I can't use bcftools on that file. Is there something I'm missing or doing wrong?

Thanks!

[Pierre Lindenbaum]

bcftools view -i 'INFO/IMP=1' myphased.vcf

it should work. what's wrong with the output ?

and it runs for a VERY long time without really outputting anything.

what's the size of the input

[Vanish007]

It's around 27GB compressed. I might try running it over a few hours and see if anything shows up. I waited about 2 hours to see something in the output file and nothing was there, but I can see if anything shows up. Thanks for confirming that the code is correct at least!

[Vanish007]

it should work. what's wrong with the output ?

Unfortunately it did not work, all that occurred was that the complete header was outputted after the command ran for 5.5 hours.

[Pierre Lindenbaum]

works on my machine:

gunzip -c rotavirus_rf.vcf.gz | grep Flag
##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">

$ bcftools view -i 'INDEL==1' rotavirus_rf.vcf.gz  | bcftools query -f '%REF %ALT %INFO/INDEL\n'
TACA TA 1
ATTT ATT 1
CAGA CA 1
ATTT AT 1
CAAAAA CAA 1

$ bcftools view -e 'INDEL==1' rotavirus_rf.vcf.gz  | bcftools query -f '%REF %ALT %INFO/INDEL\n' |head
A C .
A T .
G A .
T A .
T G .
C G .
C A .
T G .
G T .
T A .

[Vanish007]

works on my machine:

Interesting, so I tried this

 $ bcftools view -e 'IMP==0' myphased.vcf.gz  | bcftools query -f '%REF %ALT %INFO/IMP\n' |head

and received this optimistic output

   A AC 1
   T TA 1
   T TA 1
   CCGCCGTTGCAAAGGCGCGCCG C 1
   G A 1
   C G 1
   C G 1
   T G 1
   G A 1
   G C 1

I will try and run

 $ bcftools view -e 'IMP==0' myphased.vcf.gz

and see what that outputs into a file. Thanks again for the help!

[Pierre Lindenbaum]

what's the version of bcftools ?

[Vanish007]

Hi thanks for the response, I'm running the latest version

$ bcftools version
  bcftools 1.16
  Using htslib 1.16
  Copyright (C) 2022 Genome Research Ltd.
  License Expat: The MIT/Expat license
  This is free software: you are free to change and redistribute it.
  There is NO WARRANTY, to the extent permitted by law.