Entering edit mode
2.7 years ago
Joshua
▴
20
Hi,
This is my first time using GSNAP aligner. When I tried to align paired end fastq file (which contains only mitochondrial sequence) using GSNAP, I got the following error. Could anyone please guide me how I can resolve this issue.
Here are the specific reads that are causing this error.
Read1
@SRR6435655.2790253
TCTAGACCCTACCCCCAACTCCCTCCCATTAATTAGCCTTCTCTTAGCAGCAGCAGGAAAGTCAGCTCAATTCGGCCTCCATCCCTGACTCCCATCTGCCATAGAAGGCCCAGCCCCAGTCTCAGCCCTACTCCACTCCAGCACTATAGTT
+
BAA@CCB@@BB9@@@@BBBBC?@BC@@BBABBBABCB@BACBCB@BCBBCBBCBBCABCBC@CBCBCDBCCBD@AC@CCACCDAACDCCCDAACCDCDCABCCDCCDACAAC=CAAABDBCDDCDCAACCCDDACCCCACDCCCCBAAB@A
Read2
@SRR6435655.1510133
TTACTCTGCAGCCTTTCCAGGGTTTGCTGAAGATGGAGGTATTTAGGCTGGGCAAGAGGTGGTGAGGTAAATTGGGGTTTATCGATTATAGAACAGGTTCCTTTAGAGGGATATAAAGCACCGCCAAGTCCTTTGAGTTTTAAGCTGTTGC
+
A??ACDBCBB:B@BAAC@BC@@>AACBACBBCBBC@BB?@BBAABC@BBC@@BBBCBC@ADAADCD@ACCCCBDAACBBBCCD>CCBCCCDCCCCDAABCACABCDCDAACCCCCCCDCCCA@CBDDEBABDA7ED:CBCCDDDCDB?@C@
Hi!do you have the same number of reads and sorted in the same order in both files?
Thank you iraun for your guidance. I haven't sorted my fastq files before, I think that's why I got this error. After sorting the fastq file and keeping only the paired reads, I was able to resolve it.
However, I'm getting the following error now.
I think it's because my reference genome has not been indexed correctly. Previously, I downloaded the indexed genome from this website (http://research-pub.gene.com/gmap/) (UCSC hg19/GRCh37)
Then I tried to index my reference genome using gmap_build, but I got the following error. Please guide me how I can resolve this issue.
Glad that you manage to advance a bit at least. Regarding the new error.. I am not sure, can you try to specify
-d chrM
?Thank you iraun for your guidance. I'm able to index the reference genome correctly, also I'm able to align my reads with reference genome.