bwa mem error [mem_sam_pe]

Question

[ongchip]

Hello, I had trimmed fastq files with trimmomatic 0.39, and I used pe files to perform bwa mem. However, there was the error and it' stopped. This is the message:

[mem_sam_pe] paired reads have different names: "A01057:210:H37TJDSX3:2:1160:10809:6621", "A01057:210:H37TJDSX3:2:1160:13774:6621"

[mem_sam_pe] paired reads have different names: "A01057:210:H37TJDSX3:2:1160:11080:6621", "A01057:210:H37TJDSX3:2:1160:13792:6621"

The file names of fastq.gz are "17_pe1.fastq.gz" and "17_pe2.fastq.gz" How can I solve it??

[iraun]

What is the command you have used to run bwa mem? Also, did you doublecheck the fastq files to make sure that each one have the same amount of reads, and sorted in the same way?

[ongchip]

The command: nohup bwa mem -M -R "@RG\tID:HWI\tSM:17\tPL:ILLUMINA\tLB:so" -t 10 ../ref/Combined_pseudohap.phased.filtered.0.arcs.fasta.gz ../trimmed_data/17_pe1.fastq.gz ../trimmed_data/17_pe2.fastq.gz -o 17_pe.sam > 17_logs.txt &

How to doublecheck the fastq files?

[GenoMax]

You can use repair.sh utility from BBMap suite to check/re-sync your PE files.

repair.sh -Xmx4g in1=R1_001.fastq.gz in2=R2_001.fastq.gz out1=fixed_R1_001.fastq.gz out2=fixed_R2_001.fastq.gz outs=single.fastq.gz repair

[ongchip]

I tried, but there was the message:

java.lang.Exception:
Mismatch between length of bases and qualities for read 10534463 (id=A01057:210:H37TJDSX3:2:1160:22535:6668 2:N:0:TCGTAGTG+CCAAGTCT).
# qualities=151, # bases=178

FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFF,FFF:FF:FFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF
TCACTTACAGATATCAGAAACAAACTTTCGTCCACGATTGACTCTTCCGATGTTTCATCGTTGGACGACGATGGGAGATCACACAATAATTCTACGAAAACTAGAGCTTTCTTTGATTTGGATTTTACAAATTCCACAAATCTCCTGCCCAGTAGGATGTTGTAGTCAAGGTTTCCAT

This can be bypassed with the flag 'tossbrokenreads' or 'nullifybrokenquality'
        at shared.KillSwitch.kill(KillSwitch.java:96)
        at stream.Read.validateQualityLength(Read.java:217)
        at stream.Read.validate(Read.java:105)
        at stream.Read.<init>(Read.java:77)
        at stream.Read.<init>(Read.java:50)
        at stream.FASTQ.quadToRead_slow(FASTQ.java:851)
        at stream.FASTQ.toReadList(FASTQ.java:686)
        at stream.FastqReadInputStream.fillBuffer(FastqReadInputStream.java:107)
        at stream.FastqReadInputStream.nextList(FastqReadInputStream.java:93)
        at stream.ConcurrentGenericReadInputStream$ReadThread.readLists(ConcurrentGenericReadInputStream.java:682)
        at stream.ConcurrentGenericReadInputStream$ReadThread.run(ConcurrentGenericReadInputStream.java:658)

[GenoMax]

Mismatch between length of bases and qualities for read 10534463

You have a problem with your data file. Use the option indicated below with repair.sh to fix that problem

This can be bypassed with the flag 'tossbrokenreads' 

[GenoMax]

I had trimmed fastq files with trimmomatic 0.39

If you did this independently for the two files then that is the problem. You need to trim PE files together.

[ongchip]

I performed it together with one command line not seperately.